Incidental Mutation 'R7161:Lamc1'
ID557546
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Namelaminin, gamma 1
Synonymslaminin B2, Lamb2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153218922-153332786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 153226454 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1466 (L1466Q)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
Predicted Effect probably damaging
Transcript: ENSMUST00000027752
AA Change: L1466Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: L1466Q

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161744
SMART Domains Protein: ENSMUSP00000124662
Gene: ENSMUSG00000026478

DomainStartEndE-ValueType
coiled coil region 1 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163011
SMART Domains Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

DomainStartEndE-ValueType
coiled coil region 1 93 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153240495 missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153251134 missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153221573 missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153247082 missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153240433 missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153247042 missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153249853 missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153250661 missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153247055 missense probably benign 0.00
IGL03069:Lamc1 APN 1 153239381 missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153332274 missense probably benign 0.00
IGL03166:Lamc1 APN 1 153332301 missense probably benign 0.01
IGL03285:Lamc1 APN 1 153227685 missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153262646 missense probably damaging 1.00
pride UTSW 1 153247284 missense probably benign 0.01
PIT4280001:Lamc1 UTSW 1 153243471 missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153262583 missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153241868 unclassified probably benign
R0078:Lamc1 UTSW 1 153229190 missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153262607 missense probably benign 0.00
R0282:Lamc1 UTSW 1 153255312 missense probably benign
R0374:Lamc1 UTSW 1 153251065 splice site probably benign
R0494:Lamc1 UTSW 1 153246936 critical splice donor site probably null
R0502:Lamc1 UTSW 1 153246932 splice site probably benign
R0755:Lamc1 UTSW 1 153247450 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0792:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0892:Lamc1 UTSW 1 153332254 missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153332274 missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153221646 frame shift probably null
R0961:Lamc1 UTSW 1 153221700 missense probably benign 0.03
R0963:Lamc1 UTSW 1 153243386 missense probably benign
R1127:Lamc1 UTSW 1 153250459 missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153247231 splice site probably benign
R1175:Lamc1 UTSW 1 153247231 splice site probably benign
R1449:Lamc1 UTSW 1 153250495 missense probably benign
R1481:Lamc1 UTSW 1 153221634 missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153242743 missense probably benign 0.34
R1583:Lamc1 UTSW 1 153243478 critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153258072 splice site probably benign
R1652:Lamc1 UTSW 1 153249646 missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153247249 missense probably benign 0.04
R1854:Lamc1 UTSW 1 153249872 missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153242632 missense probably benign 0.07
R2170:Lamc1 UTSW 1 153249142 missense probably benign 0.07
R2410:Lamc1 UTSW 1 153247395 missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153226415 missense probably benign 0.04
R3615:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153255205 missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153262708 splice site probably null
R4285:Lamc1 UTSW 1 153234552 missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153221528 missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153247269 missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153242696 missense probably benign 0.04
R4649:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153229100 missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153233564 missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153251970 missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153247284 missense probably benign 0.01
R6233:Lamc1 UTSW 1 153223666 missense probably benign
R6431:Lamc1 UTSW 1 153221671 missense probably benign 0.21
R6636:Lamc1 UTSW 1 153241975 missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153262492 missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153234650 missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153249076 missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153332265 missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153243275 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTTCTACGCAAGCTACTGACCC -3'
(R):5'- CACCCTGAGCCATTCTACAG -3'

Sequencing Primer
(F):5'- GCTACTGACCCAATTCTTGAGGAAG -3'
(R):5'- GCCATTCTACAGATTACAAAAGGG -3'
Posted On2019-06-26