Incidental Mutation 'R7161:Wdr26'
ID 557549
Institutional Source Beutler Lab
Gene Symbol Wdr26
Ensembl Gene ENSMUSG00000038733
Gene Name WD repeat domain 26
Synonyms Gid7, 1600024A01Rik
MMRRC Submission 045260-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R7161 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181000793-181039566 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181030695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 200 (Y200H)
Ref Sequence ENSEMBL: ENSMUSP00000124592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162819] [ENSMUST00000162963]
AlphaFold Q8C6G8
Predicted Effect probably benign
Transcript: ENSMUST00000036329
SMART Domains Protein: ENSMUSP00000045177
Gene: ENSMUSG00000038733

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 43 70 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
LisH 100 132 9.73e-1 SMART
Blast:CTLH 133 183 6e-28 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162819
AA Change: Y200H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124592
Gene: ENSMUSG00000038733
AA Change: Y200H

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 211 2.41e-5 SMART
low complexity region 276 287 N/A INTRINSIC
WD40 324 363 4.76e-6 SMART
WD40 370 411 1.35e-5 SMART
WD40 414 454 2.12e-3 SMART
WD40 537 579 2.77e-1 SMART
WD40 582 622 3.83e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162963
AA Change: Y184H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124186
Gene: ENSMUSG00000038733
AA Change: Y184H

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 195 4.97e-7 SMART
low complexity region 260 271 N/A INTRINSIC
WD40 308 347 4.76e-6 SMART
WD40 354 395 1.35e-5 SMART
WD40 398 438 2.12e-3 SMART
WD40 521 563 2.77e-1 SMART
WD40 566 606 3.83e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,964,968 (GRCm39) Q443L probably benign Het
Acad12 A T 5: 121,745,436 (GRCm39) M285K probably damaging Het
Afdn T A 17: 14,109,208 (GRCm39) M1592K possibly damaging Het
Bpifb9b A T 2: 154,155,535 (GRCm39) T345S possibly damaging Het
Bub1b A G 2: 118,456,534 (GRCm39) E526G probably damaging Het
Car13 A G 3: 14,710,268 (GRCm39) D70G probably benign Het
Castor2 C A 5: 134,164,029 (GRCm39) T75N probably damaging Het
Ccdc127 A T 13: 74,500,996 (GRCm39) L4F probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccr10 A G 11: 101,065,104 (GRCm39) I142T probably benign Het
Cep126 C T 9: 8,087,400 (GRCm39) V1005M probably benign Het
Chil6 A G 3: 106,301,728 (GRCm39) I124T probably benign Het
Coq8a A G 1: 179,997,906 (GRCm39) probably null Het
Ctf2 T A 7: 127,318,476 (GRCm39) K174N probably damaging Het
Dapk1 T C 13: 60,844,209 (GRCm39) V76A possibly damaging Het
Disp1 A G 1: 182,869,189 (GRCm39) M1077T possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah9 T A 11: 65,746,198 (GRCm39) K3972* probably null Het
Dnai4 G A 4: 102,953,813 (GRCm39) P129S probably benign Het
Dusp7 T A 9: 106,246,114 (GRCm39) S40T unknown Het
Emg1 T C 6: 124,682,712 (GRCm39) T88A probably benign Het
Fbxo5 A G 10: 5,752,043 (GRCm39) V190A possibly damaging Het
Fbxw20 T G 9: 109,055,048 (GRCm39) D167A probably damaging Het
Fes A T 7: 80,030,609 (GRCm39) V562E probably damaging Het
Foxj1 C G 11: 116,223,234 (GRCm39) G190R probably damaging Het
Gdf15 T G 8: 71,083,992 (GRCm39) S91R possibly damaging Het
Gm4846 C A 1: 166,314,579 (GRCm39) V355F probably damaging Het
Herc4 T A 10: 63,144,194 (GRCm39) Y776N probably benign Het
Hspg2 G A 4: 137,242,030 (GRCm39) R588H probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Itpr1 C T 6: 108,363,601 (GRCm39) A741V probably damaging Het
Kbtbd8 T A 6: 95,103,677 (GRCm39) I519K probably benign Het
Kcnh5 T A 12: 74,944,483 (GRCm39) Q922L probably benign Het
Kiss1r T C 10: 79,755,323 (GRCm39) Y103H probably damaging Het
Knl1 A G 2: 118,901,266 (GRCm39) E989G possibly damaging Het
Lamc1 A T 1: 153,102,200 (GRCm39) L1466Q probably damaging Het
Lap3 C T 5: 45,655,809 (GRCm39) P138L probably benign Het
Lhx1 G A 11: 84,410,698 (GRCm39) P300S probably damaging Het
Mppe1 G A 18: 67,362,842 (GRCm39) A131V probably benign Het
Neb A T 2: 52,161,604 (GRCm39) Y2063N probably damaging Het
Nfe2l1 A G 11: 96,708,546 (GRCm39) F740L probably benign Het
Nop10 A G 2: 112,092,391 (GRCm39) N8S probably benign Het
Opalin T A 19: 41,058,374 (GRCm39) T20S possibly damaging Het
Or8h7 A C 2: 86,720,993 (GRCm39) H175Q probably benign Het
Pask C T 1: 93,238,627 (GRCm39) S1286N probably benign Het
Pcdhgc4 A T 18: 37,948,716 (GRCm39) E44V probably damaging Het
Pde1a A G 2: 79,695,558 (GRCm39) M463T probably benign Het
Pde6a A T 18: 61,414,596 (GRCm39) M714L probably benign Het
Pik3c2b A G 1: 133,033,850 (GRCm39) E1618G probably damaging Het
Pou2f3 T C 9: 43,050,658 (GRCm39) N234S probably damaging Het
Ptprm T A 17: 67,116,622 (GRCm39) T886S probably benign Het
Rab11fip3 C A 17: 26,288,064 (GRCm39) D30Y probably benign Het
Rassf10 A T 7: 112,553,707 (GRCm39) I103F probably damaging Het
Rfc4 A G 16: 22,934,183 (GRCm39) I206T probably benign Het
Rhcg A G 7: 79,267,189 (GRCm39) F29S probably damaging Het
Sec11c A G 18: 65,945,803 (GRCm39) I89V probably benign Het
Serac1 T C 17: 6,115,351 (GRCm39) D204G probably damaging Het
Serpinb3c T C 1: 107,200,892 (GRCm39) N175S probably null Het
Slc25a19 C T 11: 115,507,373 (GRCm39) E250K possibly damaging Het
Slc9a8 A T 2: 167,307,303 (GRCm39) Y329F possibly damaging Het
Smagp T C 15: 100,534,126 (GRCm39) probably benign Het
Spats1 T A 17: 45,760,095 (GRCm39) Q268H probably benign Het
Spef2 T C 15: 9,717,689 (GRCm39) T219A probably benign Het
Spink13 A G 18: 62,748,026 (GRCm39) M11T probably benign Het
Susd1 T C 4: 59,329,581 (GRCm39) D669G possibly damaging Het
Svep1 A G 4: 58,128,859 (GRCm39) Y613H possibly damaging Het
Tcp10b T C 17: 13,300,633 (GRCm39) *439Q probably null Het
Tmed2 T A 5: 124,684,983 (GRCm39) M133K possibly damaging Het
Trpv5 A T 6: 41,637,470 (GRCm39) Y370* probably null Het
Ttn A G 2: 76,642,588 (GRCm39) S13316P probably damaging Het
Uap1l1 A T 2: 25,253,292 (GRCm39) M381K probably damaging Het
Zfhx4 A T 3: 5,309,143 (GRCm39) M790L possibly damaging Het
Zscan25 T C 5: 145,223,251 (GRCm39) L173P probably benign Het
Other mutations in Wdr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Wdr26 APN 1 181,019,381 (GRCm39) missense possibly damaging 0.86
IGL01941:Wdr26 APN 1 181,038,635 (GRCm39) splice site probably benign
IGL02612:Wdr26 APN 1 181,005,361 (GRCm39) utr 3 prime probably benign
IGL02660:Wdr26 APN 1 181,026,463 (GRCm39) missense probably damaging 1.00
IGL02685:Wdr26 APN 1 181,011,345 (GRCm39) missense possibly damaging 0.64
IGL02884:Wdr26 APN 1 181,010,349 (GRCm39) missense probably damaging 1.00
R0396:Wdr26 UTSW 1 181,008,216 (GRCm39) intron probably benign
R0453:Wdr26 UTSW 1 181,010,444 (GRCm39) nonsense probably null
R0530:Wdr26 UTSW 1 181,013,635 (GRCm39) splice site probably null
R0729:Wdr26 UTSW 1 181,013,470 (GRCm39) splice site probably null
R1170:Wdr26 UTSW 1 181,008,859 (GRCm39) splice site probably benign
R1466:Wdr26 UTSW 1 181,013,499 (GRCm39) splice site probably benign
R1830:Wdr26 UTSW 1 181,019,340 (GRCm39) missense probably damaging 1.00
R2883:Wdr26 UTSW 1 181,038,685 (GRCm39) missense probably damaging 0.99
R4090:Wdr26 UTSW 1 181,030,679 (GRCm39) missense probably damaging 1.00
R4097:Wdr26 UTSW 1 181,010,352 (GRCm39) missense probably benign 0.00
R4953:Wdr26 UTSW 1 181,025,216 (GRCm39) missense probably damaging 1.00
R5223:Wdr26 UTSW 1 181,015,251 (GRCm39) missense probably benign 0.07
R5834:Wdr26 UTSW 1 181,030,712 (GRCm39) missense probably damaging 1.00
R5884:Wdr26 UTSW 1 181,015,106 (GRCm39) intron probably benign
R6174:Wdr26 UTSW 1 181,019,433 (GRCm39) missense probably damaging 1.00
R6334:Wdr26 UTSW 1 181,030,771 (GRCm39)
R7255:Wdr26 UTSW 1 181,008,889 (GRCm39) missense probably benign 0.24
R7406:Wdr26 UTSW 1 181,015,240 (GRCm39) missense probably damaging 1.00
R7804:Wdr26 UTSW 1 181,010,387 (GRCm39) missense probably damaging 1.00
R7815:Wdr26 UTSW 1 181,036,638 (GRCm39) missense probably benign 0.28
R8717:Wdr26 UTSW 1 181,011,913 (GRCm39) missense possibly damaging 0.92
R9072:Wdr26 UTSW 1 181,010,351 (GRCm39) missense probably damaging 0.99
R9358:Wdr26 UTSW 1 181,019,423 (GRCm39) missense probably damaging 0.98
R9520:Wdr26 UTSW 1 181,036,587 (GRCm39) missense probably benign 0.06
R9523:Wdr26 UTSW 1 181,013,620 (GRCm39) missense probably benign 0.38
R9719:Wdr26 UTSW 1 181,015,224 (GRCm39) missense possibly damaging 0.89
R9793:Wdr26 UTSW 1 181,036,812 (GRCm39) missense probably damaging 0.98
R9795:Wdr26 UTSW 1 181,036,812 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAGTCTAAGAACCCCACTTCC -3'
(R):5'- GCCTTGAGCAGTCATATTTAACCTAC -3'

Sequencing Primer
(F):5'- TTCCTTACCCACTAAAGACATGGATG -3'
(R):5'- GACTCGCAAACCAGATATTTTGAGTC -3'
Posted On 2019-06-26