Incidental Mutation 'R7161:Bpifb9b'
ID 557560
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene Name BPI fold containing family B, member 9B
Synonyms 5430413K10Rik, OTTMUSG00000015915
MMRRC Submission 045260-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R7161 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 154149164-154162564 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 154155535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 345 (T345S)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
AlphaFold A2AJD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000088921
AA Change: T345S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: T345S

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,964,968 (GRCm39) Q443L probably benign Het
Acad12 A T 5: 121,745,436 (GRCm39) M285K probably damaging Het
Afdn T A 17: 14,109,208 (GRCm39) M1592K possibly damaging Het
Bub1b A G 2: 118,456,534 (GRCm39) E526G probably damaging Het
Car13 A G 3: 14,710,268 (GRCm39) D70G probably benign Het
Castor2 C A 5: 134,164,029 (GRCm39) T75N probably damaging Het
Ccdc127 A T 13: 74,500,996 (GRCm39) L4F probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccr10 A G 11: 101,065,104 (GRCm39) I142T probably benign Het
Cep126 C T 9: 8,087,400 (GRCm39) V1005M probably benign Het
Chil6 A G 3: 106,301,728 (GRCm39) I124T probably benign Het
Coq8a A G 1: 179,997,906 (GRCm39) probably null Het
Ctf2 T A 7: 127,318,476 (GRCm39) K174N probably damaging Het
Dapk1 T C 13: 60,844,209 (GRCm39) V76A possibly damaging Het
Disp1 A G 1: 182,869,189 (GRCm39) M1077T possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah9 T A 11: 65,746,198 (GRCm39) K3972* probably null Het
Dnai4 G A 4: 102,953,813 (GRCm39) P129S probably benign Het
Dusp7 T A 9: 106,246,114 (GRCm39) S40T unknown Het
Emg1 T C 6: 124,682,712 (GRCm39) T88A probably benign Het
Fbxo5 A G 10: 5,752,043 (GRCm39) V190A possibly damaging Het
Fbxw20 T G 9: 109,055,048 (GRCm39) D167A probably damaging Het
Fes A T 7: 80,030,609 (GRCm39) V562E probably damaging Het
Foxj1 C G 11: 116,223,234 (GRCm39) G190R probably damaging Het
Gdf15 T G 8: 71,083,992 (GRCm39) S91R possibly damaging Het
Gm4846 C A 1: 166,314,579 (GRCm39) V355F probably damaging Het
Herc4 T A 10: 63,144,194 (GRCm39) Y776N probably benign Het
Hspg2 G A 4: 137,242,030 (GRCm39) R588H probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Itpr1 C T 6: 108,363,601 (GRCm39) A741V probably damaging Het
Kbtbd8 T A 6: 95,103,677 (GRCm39) I519K probably benign Het
Kcnh5 T A 12: 74,944,483 (GRCm39) Q922L probably benign Het
Kiss1r T C 10: 79,755,323 (GRCm39) Y103H probably damaging Het
Knl1 A G 2: 118,901,266 (GRCm39) E989G possibly damaging Het
Lamc1 A T 1: 153,102,200 (GRCm39) L1466Q probably damaging Het
Lap3 C T 5: 45,655,809 (GRCm39) P138L probably benign Het
Lhx1 G A 11: 84,410,698 (GRCm39) P300S probably damaging Het
Mppe1 G A 18: 67,362,842 (GRCm39) A131V probably benign Het
Neb A T 2: 52,161,604 (GRCm39) Y2063N probably damaging Het
Nfe2l1 A G 11: 96,708,546 (GRCm39) F740L probably benign Het
Nop10 A G 2: 112,092,391 (GRCm39) N8S probably benign Het
Opalin T A 19: 41,058,374 (GRCm39) T20S possibly damaging Het
Or8h7 A C 2: 86,720,993 (GRCm39) H175Q probably benign Het
Pask C T 1: 93,238,627 (GRCm39) S1286N probably benign Het
Pcdhgc4 A T 18: 37,948,716 (GRCm39) E44V probably damaging Het
Pde1a A G 2: 79,695,558 (GRCm39) M463T probably benign Het
Pde6a A T 18: 61,414,596 (GRCm39) M714L probably benign Het
Pik3c2b A G 1: 133,033,850 (GRCm39) E1618G probably damaging Het
Pou2f3 T C 9: 43,050,658 (GRCm39) N234S probably damaging Het
Ptprm T A 17: 67,116,622 (GRCm39) T886S probably benign Het
Rab11fip3 C A 17: 26,288,064 (GRCm39) D30Y probably benign Het
Rassf10 A T 7: 112,553,707 (GRCm39) I103F probably damaging Het
Rfc4 A G 16: 22,934,183 (GRCm39) I206T probably benign Het
Rhcg A G 7: 79,267,189 (GRCm39) F29S probably damaging Het
Sec11c A G 18: 65,945,803 (GRCm39) I89V probably benign Het
Serac1 T C 17: 6,115,351 (GRCm39) D204G probably damaging Het
Serpinb3c T C 1: 107,200,892 (GRCm39) N175S probably null Het
Slc25a19 C T 11: 115,507,373 (GRCm39) E250K possibly damaging Het
Slc9a8 A T 2: 167,307,303 (GRCm39) Y329F possibly damaging Het
Smagp T C 15: 100,534,126 (GRCm39) probably benign Het
Spats1 T A 17: 45,760,095 (GRCm39) Q268H probably benign Het
Spef2 T C 15: 9,717,689 (GRCm39) T219A probably benign Het
Spink13 A G 18: 62,748,026 (GRCm39) M11T probably benign Het
Susd1 T C 4: 59,329,581 (GRCm39) D669G possibly damaging Het
Svep1 A G 4: 58,128,859 (GRCm39) Y613H possibly damaging Het
Tcp10b T C 17: 13,300,633 (GRCm39) *439Q probably null Het
Tmed2 T A 5: 124,684,983 (GRCm39) M133K possibly damaging Het
Trpv5 A T 6: 41,637,470 (GRCm39) Y370* probably null Het
Ttn A G 2: 76,642,588 (GRCm39) S13316P probably damaging Het
Uap1l1 A T 2: 25,253,292 (GRCm39) M381K probably damaging Het
Wdr26 A G 1: 181,030,695 (GRCm39) Y200H probably damaging Het
Zfhx4 A T 3: 5,309,143 (GRCm39) M790L possibly damaging Het
Zscan25 T C 5: 145,223,251 (GRCm39) L173P probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154,158,871 (GRCm39) splice site probably null
IGL02119:Bpifb9b APN 2 154,155,544 (GRCm39) missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154,153,201 (GRCm39) missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154,158,995 (GRCm39) missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154,161,545 (GRCm39) missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154,161,545 (GRCm39) missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154,153,234 (GRCm39) missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154,151,524 (GRCm39) missense possibly damaging 0.93
R2160:Bpifb9b UTSW 2 154,161,595 (GRCm39) missense possibly damaging 0.53
R2200:Bpifb9b UTSW 2 154,155,574 (GRCm39) missense probably benign 0.00
R2354:Bpifb9b UTSW 2 154,153,662 (GRCm39) missense probably benign
R4755:Bpifb9b UTSW 2 154,161,614 (GRCm39) missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154,155,551 (GRCm39) missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4915:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4917:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4918:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4950:Bpifb9b UTSW 2 154,153,579 (GRCm39) missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154,151,288 (GRCm39) missense possibly damaging 0.65
R5507:Bpifb9b UTSW 2 154,158,947 (GRCm39) missense possibly damaging 0.91
R6255:Bpifb9b UTSW 2 154,151,284 (GRCm39) missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154,153,592 (GRCm39) missense probably damaging 0.98
R7736:Bpifb9b UTSW 2 154,154,025 (GRCm39) missense probably benign 0.00
R8536:Bpifb9b UTSW 2 154,158,197 (GRCm39) missense probably benign 0.00
R9134:Bpifb9b UTSW 2 154,151,441 (GRCm39) missense probably benign
R9348:Bpifb9b UTSW 2 154,160,766 (GRCm39) missense probably benign 0.28
R9528:Bpifb9b UTSW 2 154,153,297 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGAACAAACTTATTCCACTGTCTG -3'
(R):5'- GGCCACTTATAACCTGCAAGC -3'

Sequencing Primer
(F):5'- TTCCACTGTCTGAAGGATGAAGCC -3'
(R):5'- ACTTATAACCTGCAAGCGTTCTC -3'
Posted On 2019-06-26