Incidental Mutation 'R7161:Susd1'
ID557566
Institutional Source Beutler Lab
Gene Symbol Susd1
Ensembl Gene ENSMUSG00000038578
Gene Namesushi domain containing 1
SynonymsGm12528
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location59314683-59438633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59329581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 669 (D669G)
Ref Sequence ENSEMBL: ENSMUSP00000048201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040166
AA Change: D669G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: D669G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
EGF 43 77 1.36e1 SMART
EGF_CA 78 129 2.92e-7 SMART
EGF_CA 130 180 2.22e-12 SMART
CCP 184 239 7.87e-9 SMART
CCP 244 299 5.48e-8 SMART
Blast:FN3 306 379 2e-6 BLAST
Blast:FN3 459 580 8e-50 BLAST
transmembrane domain 729 751 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107544
AA Change: D616G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: D616G

DomainStartEndE-ValueType
EGF 28 76 2.02e-1 SMART
EGF_CA 77 127 2.22e-12 SMART
CCP 131 186 7.87e-9 SMART
CCP 191 246 5.48e-8 SMART
Blast:FN3 253 326 2e-6 BLAST
Blast:FN3 406 527 4e-50 BLAST
transmembrane domain 676 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Susd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Susd1 APN 4 59365817 missense possibly damaging 0.85
IGL01705:Susd1 APN 4 59332931 splice site probably benign
IGL01727:Susd1 APN 4 59412329 splice site probably benign
IGL02015:Susd1 APN 4 59315745 missense possibly damaging 0.86
IGL02102:Susd1 APN 4 59369636 missense possibly damaging 0.70
IGL02351:Susd1 APN 4 59427985 nonsense probably null
IGL02358:Susd1 APN 4 59427985 nonsense probably null
IGL03210:Susd1 APN 4 59333035 critical splice acceptor site probably null
IGL03258:Susd1 APN 4 59379655 missense possibly damaging 0.73
R0612:Susd1 UTSW 4 59390561 splice site probably benign
R0719:Susd1 UTSW 4 59329506 missense possibly damaging 0.56
R0722:Susd1 UTSW 4 59379749 missense possibly damaging 0.73
R1355:Susd1 UTSW 4 59424114 missense possibly damaging 0.86
R1672:Susd1 UTSW 4 59411395 missense probably damaging 0.98
R1677:Susd1 UTSW 4 59424089 missense possibly damaging 0.85
R1921:Susd1 UTSW 4 59412191 missense probably benign 0.03
R1933:Susd1 UTSW 4 59351695 missense possibly damaging 0.72
R1998:Susd1 UTSW 4 59349925 missense probably benign 0.03
R2202:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2203:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2204:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2329:Susd1 UTSW 4 59379715 missense possibly damaging 0.85
R2510:Susd1 UTSW 4 59349855 missense possibly damaging 0.86
R4512:Susd1 UTSW 4 59329491 missense possibly damaging 0.96
R4732:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4733:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4969:Susd1 UTSW 4 59351679 missense probably benign 0.04
R5121:Susd1 UTSW 4 59379657 missense possibly damaging 0.73
R5548:Susd1 UTSW 4 59369577 missense probably benign 0.05
R5747:Susd1 UTSW 4 59424108 missense probably damaging 0.98
R5776:Susd1 UTSW 4 59315363 utr 3 prime probably benign
R5875:Susd1 UTSW 4 59412203 missense possibly damaging 0.71
R6056:Susd1 UTSW 4 59379687 missense possibly damaging 0.53
R6081:Susd1 UTSW 4 59411359 missense possibly damaging 0.86
R7018:Susd1 UTSW 4 59390627 missense probably benign 0.44
R7122:Susd1 UTSW 4 59411318 nonsense probably null
R7172:Susd1 UTSW 4 59315420 splice site probably null
R7891:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
R7974:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTTGGTCACCGTAAACATGGG -3'
(R):5'- TGTTCTTCACAAGGCCCCTG -3'

Sequencing Primer
(F):5'- GCAAGTACACTGTAGCTGTCTTCAG -3'
(R):5'- GCCCCTGCCAATCTCTCTG -3'
Posted On2019-06-26