Incidental Mutation 'R7161:Zscan25'
ID 557574
Institutional Source Beutler Lab
Gene Symbol Zscan25
Ensembl Gene ENSMUSG00000070420
Gene Name zinc finger and SCAN domain containing 25
Synonyms Zfp498, EG666311
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock # R7161 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 145280500-145291278 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 145286441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 173 (L173P)
Ref Sequence ENSEMBL: ENSMUSP00000091664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094116] [ENSMUST00000199563] [ENSMUST00000200246]
AlphaFold B2RX31
Predicted Effect probably benign
Transcript: ENSMUST00000094116
AA Change: L173P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091664
Gene: ENSMUSG00000070420
AA Change: L173P

DomainStartEndE-ValueType
SCAN 38 150 5.94e-53 SMART
Blast:KRAB 231 288 4e-31 BLAST
ZnF_C2H2 346 368 2.15e-5 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 402 424 8.34e-3 SMART
ZnF_C2H2 430 452 3.39e-3 SMART
ZnF_C2H2 458 479 1.08e1 SMART
ZnF_C2H2 485 507 4.47e-3 SMART
ZnF_C2H2 513 536 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199563
SMART Domains Protein: ENSMUSP00000143449
Gene: ENSMUSG00000070420

DomainStartEndE-ValueType
SCAN 38 150 2.1e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200246
AA Change: L173P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142367
Gene: ENSMUSG00000070420
AA Change: L173P

DomainStartEndE-ValueType
SCAN 38 150 1.9e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that bears some similarity to zinc finger proteins, which are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants have been identified, but the full-length nature for most of them has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Other mutations in Zscan25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Zscan25 APN 5 145283749 missense probably damaging 1.00
IGL02622:Zscan25 APN 5 145290702 missense probably damaging 1.00
IGL02881:Zscan25 APN 5 145290486 missense probably benign 0.25
PIT4445001:Zscan25 UTSW 5 145290612 missense probably damaging 1.00
R1713:Zscan25 UTSW 5 145283691 missense probably damaging 0.99
R1828:Zscan25 UTSW 5 145291048 missense possibly damaging 0.95
R2233:Zscan25 UTSW 5 145283692 missense probably damaging 1.00
R3882:Zscan25 UTSW 5 145291052 missense probably damaging 1.00
R4330:Zscan25 UTSW 5 145290551 missense probably damaging 0.99
R4527:Zscan25 UTSW 5 145283458 missense probably damaging 1.00
R4539:Zscan25 UTSW 5 145288391 missense probably benign 0.01
R4598:Zscan25 UTSW 5 145291005 missense probably benign 0.30
R4611:Zscan25 UTSW 5 145291116 missense probably damaging 1.00
R4662:Zscan25 UTSW 5 145286310 missense unknown
R6733:Zscan25 UTSW 5 145290913 splice site probably null
R6751:Zscan25 UTSW 5 145290563 missense probably damaging 1.00
R7912:Zscan25 UTSW 5 145290511 missense probably benign 0.00
R8746:Zscan25 UTSW 5 145287347 missense possibly damaging 0.81
R8936:Zscan25 UTSW 5 145286390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTCCAGCAGGTCTCATTC -3'
(R):5'- TCTGCTTTCTACTGGGGCAG -3'

Sequencing Primer
(F):5'- CCAGCAGGTCTCATTCTAATTGG -3'
(R):5'- AACTCAGAATTGATTGCATCTTGCCC -3'
Posted On 2019-06-26