Incidental Mutation 'R0586:Fcgbp'
ID55758
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene NameFc fragment of IgG binding protein
SynonymsA430096B05Rik
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0586 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28071236-28120862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28089713 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 568 (D568V)
Ref Sequence ENSEMBL: ENSMUSP00000114271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: D568V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: D568V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138392
AA Change: D568V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: D568V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140004
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Cfhr2 G A 1: 139,813,434 R268* probably null Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
L3mbtl3 A G 10: 26,327,834 V366A unknown Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr1240 T A 2: 89,439,354 R308S possibly damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tns2 G T 15: 102,109,585 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trim33 T A 3: 103,310,344 C202S probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ube2e3 T C 2: 78,919,990 Y187H probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7914:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7918:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCTGAGTGAAAACACGAAAACCCTG -3'
(R):5'- AATTTGCTGGGTCACAAGGGAGTC -3'

Sequencing Primer
(F):5'- GAAAACCCTGACTGACCTGTTG -3'
(R):5'- ACAGTCACCAGGTTCAGTTGC -3'
Posted On2013-07-11