Incidental Mutation 'R7161:Fes'
ID 557581
Institutional Source Beutler Lab
Gene Symbol Fes
Ensembl Gene ENSMUSG00000053158
Gene Name feline sarcoma oncogene
Synonyms c-fes
MMRRC Submission 045260-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7161 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80027504-80037694 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80030609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 562 (V562E)
Ref Sequence ENSEMBL: ENSMUSP00000079733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206728] [ENSMUST00000206735] [ENSMUST00000206744]
AlphaFold P16879
Predicted Effect probably damaging
Transcript: ENSMUST00000080932
AA Change: V562E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: V562E

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205617
Predicted Effect probably benign
Transcript: ENSMUST00000206479
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably damaging
Transcript: ENSMUST00000206728
AA Change: V560E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000206735
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,964,968 (GRCm39) Q443L probably benign Het
Acad12 A T 5: 121,745,436 (GRCm39) M285K probably damaging Het
Afdn T A 17: 14,109,208 (GRCm39) M1592K possibly damaging Het
Bpifb9b A T 2: 154,155,535 (GRCm39) T345S possibly damaging Het
Bub1b A G 2: 118,456,534 (GRCm39) E526G probably damaging Het
Car13 A G 3: 14,710,268 (GRCm39) D70G probably benign Het
Castor2 C A 5: 134,164,029 (GRCm39) T75N probably damaging Het
Ccdc127 A T 13: 74,500,996 (GRCm39) L4F probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccr10 A G 11: 101,065,104 (GRCm39) I142T probably benign Het
Cep126 C T 9: 8,087,400 (GRCm39) V1005M probably benign Het
Chil6 A G 3: 106,301,728 (GRCm39) I124T probably benign Het
Coq8a A G 1: 179,997,906 (GRCm39) probably null Het
Ctf2 T A 7: 127,318,476 (GRCm39) K174N probably damaging Het
Dapk1 T C 13: 60,844,209 (GRCm39) V76A possibly damaging Het
Disp1 A G 1: 182,869,189 (GRCm39) M1077T possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah9 T A 11: 65,746,198 (GRCm39) K3972* probably null Het
Dnai4 G A 4: 102,953,813 (GRCm39) P129S probably benign Het
Dusp7 T A 9: 106,246,114 (GRCm39) S40T unknown Het
Emg1 T C 6: 124,682,712 (GRCm39) T88A probably benign Het
Fbxo5 A G 10: 5,752,043 (GRCm39) V190A possibly damaging Het
Fbxw20 T G 9: 109,055,048 (GRCm39) D167A probably damaging Het
Foxj1 C G 11: 116,223,234 (GRCm39) G190R probably damaging Het
Gdf15 T G 8: 71,083,992 (GRCm39) S91R possibly damaging Het
Gm4846 C A 1: 166,314,579 (GRCm39) V355F probably damaging Het
Herc4 T A 10: 63,144,194 (GRCm39) Y776N probably benign Het
Hspg2 G A 4: 137,242,030 (GRCm39) R588H probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Itpr1 C T 6: 108,363,601 (GRCm39) A741V probably damaging Het
Kbtbd8 T A 6: 95,103,677 (GRCm39) I519K probably benign Het
Kcnh5 T A 12: 74,944,483 (GRCm39) Q922L probably benign Het
Kiss1r T C 10: 79,755,323 (GRCm39) Y103H probably damaging Het
Knl1 A G 2: 118,901,266 (GRCm39) E989G possibly damaging Het
Lamc1 A T 1: 153,102,200 (GRCm39) L1466Q probably damaging Het
Lap3 C T 5: 45,655,809 (GRCm39) P138L probably benign Het
Lhx1 G A 11: 84,410,698 (GRCm39) P300S probably damaging Het
Mppe1 G A 18: 67,362,842 (GRCm39) A131V probably benign Het
Neb A T 2: 52,161,604 (GRCm39) Y2063N probably damaging Het
Nfe2l1 A G 11: 96,708,546 (GRCm39) F740L probably benign Het
Nop10 A G 2: 112,092,391 (GRCm39) N8S probably benign Het
Opalin T A 19: 41,058,374 (GRCm39) T20S possibly damaging Het
Or8h7 A C 2: 86,720,993 (GRCm39) H175Q probably benign Het
Pask C T 1: 93,238,627 (GRCm39) S1286N probably benign Het
Pcdhgc4 A T 18: 37,948,716 (GRCm39) E44V probably damaging Het
Pde1a A G 2: 79,695,558 (GRCm39) M463T probably benign Het
Pde6a A T 18: 61,414,596 (GRCm39) M714L probably benign Het
Pik3c2b A G 1: 133,033,850 (GRCm39) E1618G probably damaging Het
Pou2f3 T C 9: 43,050,658 (GRCm39) N234S probably damaging Het
Ptprm T A 17: 67,116,622 (GRCm39) T886S probably benign Het
Rab11fip3 C A 17: 26,288,064 (GRCm39) D30Y probably benign Het
Rassf10 A T 7: 112,553,707 (GRCm39) I103F probably damaging Het
Rfc4 A G 16: 22,934,183 (GRCm39) I206T probably benign Het
Rhcg A G 7: 79,267,189 (GRCm39) F29S probably damaging Het
Sec11c A G 18: 65,945,803 (GRCm39) I89V probably benign Het
Serac1 T C 17: 6,115,351 (GRCm39) D204G probably damaging Het
Serpinb3c T C 1: 107,200,892 (GRCm39) N175S probably null Het
Slc25a19 C T 11: 115,507,373 (GRCm39) E250K possibly damaging Het
Slc9a8 A T 2: 167,307,303 (GRCm39) Y329F possibly damaging Het
Smagp T C 15: 100,534,126 (GRCm39) probably benign Het
Spats1 T A 17: 45,760,095 (GRCm39) Q268H probably benign Het
Spef2 T C 15: 9,717,689 (GRCm39) T219A probably benign Het
Spink13 A G 18: 62,748,026 (GRCm39) M11T probably benign Het
Susd1 T C 4: 59,329,581 (GRCm39) D669G possibly damaging Het
Svep1 A G 4: 58,128,859 (GRCm39) Y613H possibly damaging Het
Tcp10b T C 17: 13,300,633 (GRCm39) *439Q probably null Het
Tmed2 T A 5: 124,684,983 (GRCm39) M133K possibly damaging Het
Trpv5 A T 6: 41,637,470 (GRCm39) Y370* probably null Het
Ttn A G 2: 76,642,588 (GRCm39) S13316P probably damaging Het
Uap1l1 A T 2: 25,253,292 (GRCm39) M381K probably damaging Het
Wdr26 A G 1: 181,030,695 (GRCm39) Y200H probably damaging Het
Zfhx4 A T 3: 5,309,143 (GRCm39) M790L possibly damaging Het
Zscan25 T C 5: 145,223,251 (GRCm39) L173P probably benign Het
Other mutations in Fes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Fes APN 7 80,033,021 (GRCm39) missense probably benign 0.01
IGL01654:Fes APN 7 80,036,558 (GRCm39) critical splice donor site probably null
IGL02350:Fes APN 7 80,033,578 (GRCm39) splice site probably null
IGL02357:Fes APN 7 80,033,578 (GRCm39) splice site probably null
IGL02811:Fes APN 7 80,029,589 (GRCm39) missense probably damaging 1.00
BB009:Fes UTSW 7 80,029,620 (GRCm39) missense probably damaging 0.99
BB019:Fes UTSW 7 80,029,620 (GRCm39) missense probably damaging 0.99
R0112:Fes UTSW 7 80,033,753 (GRCm39) missense probably damaging 0.99
R0114:Fes UTSW 7 80,027,783 (GRCm39) missense probably damaging 0.99
R0143:Fes UTSW 7 80,033,643 (GRCm39) missense probably benign 0.00
R0786:Fes UTSW 7 80,036,668 (GRCm39) missense probably damaging 1.00
R0863:Fes UTSW 7 80,030,634 (GRCm39) missense probably damaging 1.00
R0918:Fes UTSW 7 80,030,953 (GRCm39) missense probably damaging 1.00
R1167:Fes UTSW 7 80,032,857 (GRCm39) missense probably damaging 1.00
R1174:Fes UTSW 7 80,027,699 (GRCm39) missense probably damaging 1.00
R1674:Fes UTSW 7 80,027,686 (GRCm39) missense probably benign 0.04
R1898:Fes UTSW 7 80,029,659 (GRCm39) missense probably damaging 1.00
R1908:Fes UTSW 7 80,036,609 (GRCm39) missense probably damaging 0.98
R1909:Fes UTSW 7 80,036,609 (GRCm39) missense probably damaging 0.98
R1922:Fes UTSW 7 80,033,734 (GRCm39) nonsense probably null
R2209:Fes UTSW 7 80,030,031 (GRCm39) missense probably damaging 1.00
R2242:Fes UTSW 7 80,031,473 (GRCm39) missense probably damaging 1.00
R3012:Fes UTSW 7 80,036,915 (GRCm39) missense possibly damaging 0.81
R4607:Fes UTSW 7 80,036,959 (GRCm39) missense probably damaging 1.00
R4608:Fes UTSW 7 80,036,959 (GRCm39) missense probably damaging 1.00
R4982:Fes UTSW 7 80,036,952 (GRCm39) missense probably damaging 1.00
R5516:Fes UTSW 7 80,036,931 (GRCm39) missense probably damaging 1.00
R6120:Fes UTSW 7 80,030,615 (GRCm39) missense probably damaging 1.00
R6148:Fes UTSW 7 80,030,044 (GRCm39) missense probably damaging 1.00
R7401:Fes UTSW 7 80,028,524 (GRCm39) critical splice donor site probably null
R7408:Fes UTSW 7 80,028,410 (GRCm39) missense probably damaging 1.00
R7761:Fes UTSW 7 80,030,615 (GRCm39) missense probably damaging 1.00
R7932:Fes UTSW 7 80,029,620 (GRCm39) missense probably damaging 0.99
R8261:Fes UTSW 7 80,032,902 (GRCm39) missense probably null 1.00
R8815:Fes UTSW 7 80,033,619 (GRCm39) missense possibly damaging 0.89
R8903:Fes UTSW 7 80,036,559 (GRCm39) unclassified probably benign
R8936:Fes UTSW 7 80,031,473 (GRCm39) missense probably damaging 1.00
R9012:Fes UTSW 7 80,032,884 (GRCm39) missense possibly damaging 0.78
R9174:Fes UTSW 7 80,030,631 (GRCm39) missense probably damaging 0.98
R9200:Fes UTSW 7 80,032,140 (GRCm39) missense probably benign 0.00
R9679:Fes UTSW 7 80,033,050 (GRCm39) missense probably benign 0.04
Z1177:Fes UTSW 7 80,027,778 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTCATTGGGTCAGGGAGAC -3'
(R):5'- AGCGTTACCCCACAATGTG -3'

Sequencing Primer
(F):5'- AGACCCTCTAGGACTCTGGAG -3'
(R):5'- TGGGCCATAGATATCAGCCTGATC -3'
Posted On 2019-06-26