Mutagenetix > Incidental Mutation

Incidental Mutation 'R7161:Fes'

557581

Institutional Source

Beutler Lab

Gene Symbol

Fes

Ensembl Gene

ENSMUSG00000053158

Gene Name

feline sarcoma oncogene

Synonyms

c-fes

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80377756-80387946 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80380861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 562 (V562E)

Ref Sequence

ENSEMBL: ENSMUSP00000079733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206728] [ENSMUST00000206735] [ENSMUST00000206744]

AlphaFold

P16879

Predicted Effect

probably damaging
Transcript: ENSMUST00000080932
AA Change: V562E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: V562E

Domain	Start	End	E-Value	Type
FCH	1	94	2.22e-26	SMART
coiled coil region	133	165	N/A	INTRINSIC
coiled coil region	320	344	N/A	INTRINSIC
SH2	458	536	8.41e-26	SMART
TyrKc	561	814	1.57e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205617

Predicted Effect

probably benign
Transcript: ENSMUST00000206479

Predicted Effect

probably benign
Transcript: ENSMUST00000206539

Predicted Effect

probably damaging
Transcript: ENSMUST00000206728
AA Change: V560E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000206735

Predicted Effect

probably benign
Transcript: ENSMUST00000206744

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abca8a	T	A	11: 110,074,142	Q443L	probably benign	Het
Acad12	A	T	5: 121,607,373	M285K	probably damaging	Het
Afdn	T	A	17: 13,888,946	M1592K	possibly damaging	Het
Bpifb9b	A	T	2: 154,313,615	T345S	possibly damaging	Het
Bub1b	A	G	2: 118,626,053	E526G	probably damaging	Het
Car13	A	G	3: 14,645,208	D70G	probably benign	Het
Ccdc127	A	T	13: 74,352,877	L4F	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Ccr10	A	G	11: 101,174,278	I142T	probably benign	Het
Cep126	C	T	9: 8,087,399	V1005M	probably benign	Het
Chil6	A	G	3: 106,394,412	I124T	probably benign	Het
Coq8a	A	G	1: 180,170,341		probably null	Het
Ctf2	T	A	7: 127,719,304	K174N	probably damaging	Het
Dapk1	T	C	13: 60,696,395	V76A	possibly damaging	Het
Disp1	A	G	1: 183,087,625	M1077T	possibly damaging	Het
Dnah9	T	A	11: 65,855,372	K3972*	probably null	Het
Dusp7	T	A	9: 106,368,915	S40T	unknown	Het
Emg1	T	C	6: 124,705,749	T88A	probably benign	Het
Fbxo5	A	G	10: 5,802,043	V190A	possibly damaging	Het
Fbxw20	T	G	9: 109,225,980	D167A	probably damaging	Het
Foxj1	C	G	11: 116,332,408	G190R	probably damaging	Het
Gatsl2	C	A	5: 134,135,190	T75N	probably damaging	Het
Gdf15	T	G	8: 70,631,342	S91R	possibly damaging	Het
Gm4846	C	A	1: 166,487,010	V355F	probably damaging	Het
Herc4	T	A	10: 63,308,415	Y776N	probably benign	Het
Hspg2	G	A	4: 137,514,719	R588H	probably damaging	Het
Igkv6-25	T	A	6: 70,215,778	Y56*	probably null	Het
Itpr1	C	T	6: 108,386,640	A741V	probably damaging	Het
Kbtbd8	T	A	6: 95,126,696	I519K	probably benign	Het
Kcnh5	T	A	12: 74,897,709	Q922L	probably benign	Het
Kiss1r	T	C	10: 79,919,489	Y103H	probably damaging	Het
Knl1	A	G	2: 119,070,785	E989G	possibly damaging	Het
Lamc1	A	T	1: 153,226,454	L1466Q	probably damaging	Het
Lap3	C	T	5: 45,498,467	P138L	probably benign	Het
Lhx1	G	A	11: 84,519,872	P300S	probably damaging	Het
Mppe1	G	A	18: 67,229,771	A131V	probably benign	Het
Neb	A	T	2: 52,271,592	Y2063N	probably damaging	Het
Nfe2l1	A	G	11: 96,817,720	F740L	probably benign	Het
Nop10	A	G	2: 112,262,046	N8S	probably benign	Het
Olfr1097	A	C	2: 86,890,649	H175Q	probably benign	Het
Opalin	T	A	19: 41,069,935	T20S	possibly damaging	Het
Pask	C	T	1: 93,310,905	S1286N	probably benign	Het
Pcdhgc4	A	T	18: 37,815,663	E44V	probably damaging	Het
Pde1a	A	G	2: 79,865,214	M463T	probably benign	Het
Pde6a	A	T	18: 61,281,525	M714L	probably benign	Het
Pik3c2b	A	G	1: 133,106,112	E1618G	probably damaging	Het
Pou2f3	T	C	9: 43,139,363	N234S	probably damaging	Het
Ptprm	T	A	17: 66,809,627	T886S	probably benign	Het
Rab11fip3	C	A	17: 26,069,090	D30Y	probably benign	Het
Rassf10	A	T	7: 112,954,500	I103F	probably damaging	Het
Rfc4	A	G	16: 23,115,433	I206T	probably benign	Het
Rhcg	A	G	7: 79,617,441	F29S	probably damaging	Het
Sec11c	A	G	18: 65,812,732	I89V	probably benign	Het
Serac1	T	C	17: 6,065,076	D204G	probably damaging	Het
Serpinb3c	T	C	1: 107,273,162	N175S	probably null	Het
Slc25a19	C	T	11: 115,616,547	E250K	possibly damaging	Het
Slc9a8	A	T	2: 167,465,383	Y329F	possibly damaging	Het
Smagp	T	C	15: 100,636,245		probably benign	Het
Spats1	T	A	17: 45,449,169	Q268H	probably benign	Het
Spef2	T	C	15: 9,717,603	T219A	probably benign	Het
Spink13	A	G	18: 62,614,955	M11T	probably benign	Het
Susd1	T	C	4: 59,329,581	D669G	possibly damaging	Het
Svep1	A	G	4: 58,128,859	Y613H	possibly damaging	Het
Tcp10b	T	C	17: 13,081,746	*439Q	probably null	Het
Tmed2	T	A	5: 124,546,920	M133K	possibly damaging	Het
Trpv5	A	T	6: 41,660,536	Y370*	probably null	Het
Ttn	A	G	2: 76,812,244	S13316P	probably damaging	Het
Uap1l1	A	T	2: 25,363,280	M381K	probably damaging	Het
Wdr26	A	G	1: 181,203,130	Y200H	probably damaging	Het
Wdr78	G	A	4: 103,096,616	P129S	probably benign	Het
Zfhx4	A	T	3: 5,244,083	M790L	possibly damaging	Het
Zscan25	T	C	5: 145,286,441	L173P	probably benign	Het

Other mutations in Fes

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01470:Fes	APN	7	80383273	missense	probably benign	0.01
IGL01654:Fes	APN	7	80386810	critical splice donor site	probably null
IGL02350:Fes	APN	7	80383830	splice site	probably null
IGL02357:Fes	APN	7	80383830	splice site	probably null
IGL02811:Fes	APN	7	80379841	missense	probably damaging	1.00
BB009:Fes	UTSW	7	80379872	missense	probably damaging	0.99
BB019:Fes	UTSW	7	80379872	missense	probably damaging	0.99
R0112:Fes	UTSW	7	80384005	missense	probably damaging	0.99
R0114:Fes	UTSW	7	80378035	missense	probably damaging	0.99
R0143:Fes	UTSW	7	80383895	missense	probably benign	0.00
R0786:Fes	UTSW	7	80386920	missense	probably damaging	1.00
R0863:Fes	UTSW	7	80380886	missense	probably damaging	1.00
R0918:Fes	UTSW	7	80381205	missense	probably damaging	1.00
R1167:Fes	UTSW	7	80383109	missense	probably damaging	1.00
R1174:Fes	UTSW	7	80377951	missense	probably damaging	1.00
R1674:Fes	UTSW	7	80377938	missense	probably benign	0.04
R1898:Fes	UTSW	7	80379911	missense	probably damaging	1.00
R1908:Fes	UTSW	7	80386861	missense	probably damaging	0.98
R1909:Fes	UTSW	7	80386861	missense	probably damaging	0.98
R1922:Fes	UTSW	7	80383986	nonsense	probably null
R2209:Fes	UTSW	7	80380283	missense	probably damaging	1.00
R2242:Fes	UTSW	7	80381725	missense	probably damaging	1.00
R3012:Fes	UTSW	7	80387167	missense	possibly damaging	0.81
R4607:Fes	UTSW	7	80387211	missense	probably damaging	1.00
R4608:Fes	UTSW	7	80387211	missense	probably damaging	1.00
R4982:Fes	UTSW	7	80387204	missense	probably damaging	1.00
R5516:Fes	UTSW	7	80387183	missense	probably damaging	1.00
R6120:Fes	UTSW	7	80380867	missense	probably damaging	1.00
R6148:Fes	UTSW	7	80380296	missense	probably damaging	1.00
R7401:Fes	UTSW	7	80378776	critical splice donor site	probably null
R7408:Fes	UTSW	7	80378662	missense	probably damaging	1.00
R7761:Fes	UTSW	7	80380867	missense	probably damaging	1.00
R7932:Fes	UTSW	7	80379872	missense	probably damaging	0.99
R8261:Fes	UTSW	7	80383154	missense	probably null	1.00
R8815:Fes	UTSW	7	80383871	missense	possibly damaging	0.89
R8903:Fes	UTSW	7	80386811	unclassified	probably benign
R8936:Fes	UTSW	7	80381725	missense	probably damaging	1.00
R9012:Fes	UTSW	7	80383136	missense	possibly damaging	0.78
R9174:Fes	UTSW	7	80380883	missense	probably damaging	0.98
R9200:Fes	UTSW	7	80382392	missense	probably benign	0.00
R9679:Fes	UTSW	7	80383302	missense	probably benign	0.04
Z1177:Fes	UTSW	7	80378030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCTCATTGGGTCAGGGAGAC -3'
(R):5'- AGCGTTACCCCACAATGTG -3'

Sequencing Primer
(F):5'- AGACCCTCTAGGACTCTGGAG -3'
(R):5'- TGGGCCATAGATATCAGCCTGATC -3'

Posted On

2019-06-26