Incidental Mutation 'R7161:Pou2f3'
ID 557586
Institutional Source Beutler Lab
Gene Symbol Pou2f3
Ensembl Gene ENSMUSG00000032015
Gene Name POU domain, class 2, transcription factor 3
Synonyms Skn-1a, Otf-11, Epoc-1, Skn-li, Oct-11a, Skin, Oct11, Skin-1a, Otf11
MMRRC Submission 045260-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7161 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 43035222-43117052 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43050658 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 234 (N234S)
Ref Sequence ENSEMBL: ENSMUSP00000135115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034513
AA Change: N222S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: N222S

DomainStartEndE-ValueType
low complexity region 107 122 N/A INTRINSIC
low complexity region 150 162 N/A INTRINSIC
POU 164 238 1.47e-53 SMART
low complexity region 239 256 N/A INTRINSIC
HOX 262 324 8.39e-20 SMART
low complexity region 337 352 N/A INTRINSIC
low complexity region 362 378 N/A INTRINSIC
low complexity region 386 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176636
AA Change: N234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: N234S

DomainStartEndE-ValueType
low complexity region 119 134 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
POU 176 250 1.47e-53 SMART
low complexity region 251 268 N/A INTRINSIC
HOX 274 336 8.39e-20 SMART
low complexity region 349 364 N/A INTRINSIC
low complexity region 374 390 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,964,968 (GRCm39) Q443L probably benign Het
Acad12 A T 5: 121,745,436 (GRCm39) M285K probably damaging Het
Afdn T A 17: 14,109,208 (GRCm39) M1592K possibly damaging Het
Bpifb9b A T 2: 154,155,535 (GRCm39) T345S possibly damaging Het
Bub1b A G 2: 118,456,534 (GRCm39) E526G probably damaging Het
Car13 A G 3: 14,710,268 (GRCm39) D70G probably benign Het
Castor2 C A 5: 134,164,029 (GRCm39) T75N probably damaging Het
Ccdc127 A T 13: 74,500,996 (GRCm39) L4F probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccr10 A G 11: 101,065,104 (GRCm39) I142T probably benign Het
Cep126 C T 9: 8,087,400 (GRCm39) V1005M probably benign Het
Chil6 A G 3: 106,301,728 (GRCm39) I124T probably benign Het
Coq8a A G 1: 179,997,906 (GRCm39) probably null Het
Ctf2 T A 7: 127,318,476 (GRCm39) K174N probably damaging Het
Dapk1 T C 13: 60,844,209 (GRCm39) V76A possibly damaging Het
Disp1 A G 1: 182,869,189 (GRCm39) M1077T possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah9 T A 11: 65,746,198 (GRCm39) K3972* probably null Het
Dnai4 G A 4: 102,953,813 (GRCm39) P129S probably benign Het
Dusp7 T A 9: 106,246,114 (GRCm39) S40T unknown Het
Emg1 T C 6: 124,682,712 (GRCm39) T88A probably benign Het
Fbxo5 A G 10: 5,752,043 (GRCm39) V190A possibly damaging Het
Fbxw20 T G 9: 109,055,048 (GRCm39) D167A probably damaging Het
Fes A T 7: 80,030,609 (GRCm39) V562E probably damaging Het
Foxj1 C G 11: 116,223,234 (GRCm39) G190R probably damaging Het
Gdf15 T G 8: 71,083,992 (GRCm39) S91R possibly damaging Het
Gm4846 C A 1: 166,314,579 (GRCm39) V355F probably damaging Het
Herc4 T A 10: 63,144,194 (GRCm39) Y776N probably benign Het
Hspg2 G A 4: 137,242,030 (GRCm39) R588H probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Itpr1 C T 6: 108,363,601 (GRCm39) A741V probably damaging Het
Kbtbd8 T A 6: 95,103,677 (GRCm39) I519K probably benign Het
Kcnh5 T A 12: 74,944,483 (GRCm39) Q922L probably benign Het
Kiss1r T C 10: 79,755,323 (GRCm39) Y103H probably damaging Het
Knl1 A G 2: 118,901,266 (GRCm39) E989G possibly damaging Het
Lamc1 A T 1: 153,102,200 (GRCm39) L1466Q probably damaging Het
Lap3 C T 5: 45,655,809 (GRCm39) P138L probably benign Het
Lhx1 G A 11: 84,410,698 (GRCm39) P300S probably damaging Het
Mppe1 G A 18: 67,362,842 (GRCm39) A131V probably benign Het
Neb A T 2: 52,161,604 (GRCm39) Y2063N probably damaging Het
Nfe2l1 A G 11: 96,708,546 (GRCm39) F740L probably benign Het
Nop10 A G 2: 112,092,391 (GRCm39) N8S probably benign Het
Opalin T A 19: 41,058,374 (GRCm39) T20S possibly damaging Het
Or8h7 A C 2: 86,720,993 (GRCm39) H175Q probably benign Het
Pask C T 1: 93,238,627 (GRCm39) S1286N probably benign Het
Pcdhgc4 A T 18: 37,948,716 (GRCm39) E44V probably damaging Het
Pde1a A G 2: 79,695,558 (GRCm39) M463T probably benign Het
Pde6a A T 18: 61,414,596 (GRCm39) M714L probably benign Het
Pik3c2b A G 1: 133,033,850 (GRCm39) E1618G probably damaging Het
Ptprm T A 17: 67,116,622 (GRCm39) T886S probably benign Het
Rab11fip3 C A 17: 26,288,064 (GRCm39) D30Y probably benign Het
Rassf10 A T 7: 112,553,707 (GRCm39) I103F probably damaging Het
Rfc4 A G 16: 22,934,183 (GRCm39) I206T probably benign Het
Rhcg A G 7: 79,267,189 (GRCm39) F29S probably damaging Het
Sec11c A G 18: 65,945,803 (GRCm39) I89V probably benign Het
Serac1 T C 17: 6,115,351 (GRCm39) D204G probably damaging Het
Serpinb3c T C 1: 107,200,892 (GRCm39) N175S probably null Het
Slc25a19 C T 11: 115,507,373 (GRCm39) E250K possibly damaging Het
Slc9a8 A T 2: 167,307,303 (GRCm39) Y329F possibly damaging Het
Smagp T C 15: 100,534,126 (GRCm39) probably benign Het
Spats1 T A 17: 45,760,095 (GRCm39) Q268H probably benign Het
Spef2 T C 15: 9,717,689 (GRCm39) T219A probably benign Het
Spink13 A G 18: 62,748,026 (GRCm39) M11T probably benign Het
Susd1 T C 4: 59,329,581 (GRCm39) D669G possibly damaging Het
Svep1 A G 4: 58,128,859 (GRCm39) Y613H possibly damaging Het
Tcp10b T C 17: 13,300,633 (GRCm39) *439Q probably null Het
Tmed2 T A 5: 124,684,983 (GRCm39) M133K possibly damaging Het
Trpv5 A T 6: 41,637,470 (GRCm39) Y370* probably null Het
Ttn A G 2: 76,642,588 (GRCm39) S13316P probably damaging Het
Uap1l1 A T 2: 25,253,292 (GRCm39) M381K probably damaging Het
Wdr26 A G 1: 181,030,695 (GRCm39) Y200H probably damaging Het
Zfhx4 A T 3: 5,309,143 (GRCm39) M790L possibly damaging Het
Zscan25 T C 5: 145,223,251 (GRCm39) L173P probably benign Het
Other mutations in Pou2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pou2f3 APN 9 43,040,188 (GRCm39) missense probably damaging 1.00
IGL00508:Pou2f3 APN 9 43,051,258 (GRCm39) missense probably benign 0.01
IGL00975:Pou2f3 APN 9 43,048,679 (GRCm39) missense probably benign
IGL01577:Pou2f3 APN 9 43,058,178 (GRCm39) nonsense probably null
IGL01871:Pou2f3 APN 9 43,045,768 (GRCm39) splice site probably benign
IGL02370:Pou2f3 APN 9 43,048,643 (GRCm39) missense probably damaging 1.00
IGL02674:Pou2f3 APN 9 43,050,628 (GRCm39) missense probably damaging 1.00
IGL02746:Pou2f3 APN 9 43,058,143 (GRCm39) missense probably benign 0.01
IGL02956:Pou2f3 APN 9 43,054,100 (GRCm39) splice site probably benign
IGL02962:Pou2f3 APN 9 43,036,384 (GRCm39) utr 3 prime probably benign
IGL03082:Pou2f3 APN 9 43,058,212 (GRCm39) critical splice acceptor site probably null
R0433:Pou2f3 UTSW 9 43,038,693 (GRCm39) missense probably benign 0.23
R0622:Pou2f3 UTSW 9 43,036,414 (GRCm39) missense probably damaging 1.00
R0926:Pou2f3 UTSW 9 43,058,198 (GRCm39) missense probably damaging 1.00
R1956:Pou2f3 UTSW 9 43,056,534 (GRCm39) missense probably benign
R4782:Pou2f3 UTSW 9 43,051,153 (GRCm39) missense probably damaging 0.97
R4877:Pou2f3 UTSW 9 43,050,618 (GRCm39) missense possibly damaging 0.58
R5070:Pou2f3 UTSW 9 43,056,578 (GRCm39) missense possibly damaging 0.52
R5910:Pou2f3 UTSW 9 43,045,769 (GRCm39) splice site probably null
R6280:Pou2f3 UTSW 9 43,050,635 (GRCm39) missense probably damaging 1.00
R6280:Pou2f3 UTSW 9 43,050,634 (GRCm39) missense probably damaging 1.00
R6465:Pou2f3 UTSW 9 43,051,162 (GRCm39) missense probably damaging 1.00
R7084:Pou2f3 UTSW 9 43,040,188 (GRCm39) missense probably damaging 1.00
R8036:Pou2f3 UTSW 9 43,058,205 (GRCm39) missense probably damaging 1.00
R8406:Pou2f3 UTSW 9 43,051,153 (GRCm39) missense probably damaging 0.97
R8912:Pou2f3 UTSW 9 43,110,336 (GRCm39) missense probably benign 0.00
R9224:Pou2f3 UTSW 9 43,050,694 (GRCm39) missense probably damaging 1.00
R9329:Pou2f3 UTSW 9 43,040,224 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTCTTGGTTCGTGCCAG -3'
(R):5'- AGATACAAGGCTGTGCGCAG -3'

Sequencing Primer
(F):5'- TTCGTGCCAGGCTGAAGAG -3'
(R):5'- AGATGCTCAGGGCTCTGACTG -3'
Posted On 2019-06-26