Incidental Mutation 'R7161:Dusp7'
ID 557587
Institutional Source Beutler Lab
Gene Symbol Dusp7
Ensembl Gene ENSMUSG00000053716
Gene Name dual specificity phosphatase 7
Synonyms PYST2, MKP-X
MMRRC Submission 045260-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # R7161 (G1)
Quality Score 104.008
Status Validated
Chromosome 9
Chromosomal Location 106245831-106252923 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106246114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 40 (S40T)
Ref Sequence ENSEMBL: ENSMUSP00000126984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172306]
AlphaFold Q91Z46
Predicted Effect unknown
Transcript: ENSMUST00000172306
AA Change: S40T
SMART Domains Protein: ENSMUSP00000126984
Gene: ENSMUSG00000053716
AA Change: S40T

DomainStartEndE-ValueType
low complexity region 18 54 N/A INTRINSIC
RHOD 58 187 4.5e-11 SMART
low complexity region 195 213 N/A INTRINSIC
DSPc 247 387 8.53e-71 SMART
Blast:DSPc 393 416 8e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173748
SMART Domains Protein: ENSMUSP00000133511
Gene: ENSMUSG00000053716

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
DSPc 58 214 4.41e-64 SMART
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. DUSP7 belongs to a class of DUSPs, designated MKPs, that dephosphorylate MAPK (mitogen-activated protein kinase) proteins ERK (see MIM 601795), JNK (see MIM 601158), and p38 (see MIM 600289) with specificity distinct from that of individual MKP proteins. MKPs contain a highly conserved C-terminal catalytic domain and an N-terminal Cdc25 (see MIM 116947)-like (CH2) domain. MAPK activation cascades mediate various physiologic processes, including cellular proliferation, apoptosis, differentiation, and stress responses (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,964,968 (GRCm39) Q443L probably benign Het
Acad12 A T 5: 121,745,436 (GRCm39) M285K probably damaging Het
Afdn T A 17: 14,109,208 (GRCm39) M1592K possibly damaging Het
Bpifb9b A T 2: 154,155,535 (GRCm39) T345S possibly damaging Het
Bub1b A G 2: 118,456,534 (GRCm39) E526G probably damaging Het
Car13 A G 3: 14,710,268 (GRCm39) D70G probably benign Het
Castor2 C A 5: 134,164,029 (GRCm39) T75N probably damaging Het
Ccdc127 A T 13: 74,500,996 (GRCm39) L4F probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccr10 A G 11: 101,065,104 (GRCm39) I142T probably benign Het
Cep126 C T 9: 8,087,400 (GRCm39) V1005M probably benign Het
Chil6 A G 3: 106,301,728 (GRCm39) I124T probably benign Het
Coq8a A G 1: 179,997,906 (GRCm39) probably null Het
Ctf2 T A 7: 127,318,476 (GRCm39) K174N probably damaging Het
Dapk1 T C 13: 60,844,209 (GRCm39) V76A possibly damaging Het
Disp1 A G 1: 182,869,189 (GRCm39) M1077T possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah9 T A 11: 65,746,198 (GRCm39) K3972* probably null Het
Dnai4 G A 4: 102,953,813 (GRCm39) P129S probably benign Het
Emg1 T C 6: 124,682,712 (GRCm39) T88A probably benign Het
Fbxo5 A G 10: 5,752,043 (GRCm39) V190A possibly damaging Het
Fbxw20 T G 9: 109,055,048 (GRCm39) D167A probably damaging Het
Fes A T 7: 80,030,609 (GRCm39) V562E probably damaging Het
Foxj1 C G 11: 116,223,234 (GRCm39) G190R probably damaging Het
Gdf15 T G 8: 71,083,992 (GRCm39) S91R possibly damaging Het
Gm4846 C A 1: 166,314,579 (GRCm39) V355F probably damaging Het
Herc4 T A 10: 63,144,194 (GRCm39) Y776N probably benign Het
Hspg2 G A 4: 137,242,030 (GRCm39) R588H probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Itpr1 C T 6: 108,363,601 (GRCm39) A741V probably damaging Het
Kbtbd8 T A 6: 95,103,677 (GRCm39) I519K probably benign Het
Kcnh5 T A 12: 74,944,483 (GRCm39) Q922L probably benign Het
Kiss1r T C 10: 79,755,323 (GRCm39) Y103H probably damaging Het
Knl1 A G 2: 118,901,266 (GRCm39) E989G possibly damaging Het
Lamc1 A T 1: 153,102,200 (GRCm39) L1466Q probably damaging Het
Lap3 C T 5: 45,655,809 (GRCm39) P138L probably benign Het
Lhx1 G A 11: 84,410,698 (GRCm39) P300S probably damaging Het
Mppe1 G A 18: 67,362,842 (GRCm39) A131V probably benign Het
Neb A T 2: 52,161,604 (GRCm39) Y2063N probably damaging Het
Nfe2l1 A G 11: 96,708,546 (GRCm39) F740L probably benign Het
Nop10 A G 2: 112,092,391 (GRCm39) N8S probably benign Het
Opalin T A 19: 41,058,374 (GRCm39) T20S possibly damaging Het
Or8h7 A C 2: 86,720,993 (GRCm39) H175Q probably benign Het
Pask C T 1: 93,238,627 (GRCm39) S1286N probably benign Het
Pcdhgc4 A T 18: 37,948,716 (GRCm39) E44V probably damaging Het
Pde1a A G 2: 79,695,558 (GRCm39) M463T probably benign Het
Pde6a A T 18: 61,414,596 (GRCm39) M714L probably benign Het
Pik3c2b A G 1: 133,033,850 (GRCm39) E1618G probably damaging Het
Pou2f3 T C 9: 43,050,658 (GRCm39) N234S probably damaging Het
Ptprm T A 17: 67,116,622 (GRCm39) T886S probably benign Het
Rab11fip3 C A 17: 26,288,064 (GRCm39) D30Y probably benign Het
Rassf10 A T 7: 112,553,707 (GRCm39) I103F probably damaging Het
Rfc4 A G 16: 22,934,183 (GRCm39) I206T probably benign Het
Rhcg A G 7: 79,267,189 (GRCm39) F29S probably damaging Het
Sec11c A G 18: 65,945,803 (GRCm39) I89V probably benign Het
Serac1 T C 17: 6,115,351 (GRCm39) D204G probably damaging Het
Serpinb3c T C 1: 107,200,892 (GRCm39) N175S probably null Het
Slc25a19 C T 11: 115,507,373 (GRCm39) E250K possibly damaging Het
Slc9a8 A T 2: 167,307,303 (GRCm39) Y329F possibly damaging Het
Smagp T C 15: 100,534,126 (GRCm39) probably benign Het
Spats1 T A 17: 45,760,095 (GRCm39) Q268H probably benign Het
Spef2 T C 15: 9,717,689 (GRCm39) T219A probably benign Het
Spink13 A G 18: 62,748,026 (GRCm39) M11T probably benign Het
Susd1 T C 4: 59,329,581 (GRCm39) D669G possibly damaging Het
Svep1 A G 4: 58,128,859 (GRCm39) Y613H possibly damaging Het
Tcp10b T C 17: 13,300,633 (GRCm39) *439Q probably null Het
Tmed2 T A 5: 124,684,983 (GRCm39) M133K possibly damaging Het
Trpv5 A T 6: 41,637,470 (GRCm39) Y370* probably null Het
Ttn A G 2: 76,642,588 (GRCm39) S13316P probably damaging Het
Uap1l1 A T 2: 25,253,292 (GRCm39) M381K probably damaging Het
Wdr26 A G 1: 181,030,695 (GRCm39) Y200H probably damaging Het
Zfhx4 A T 3: 5,309,143 (GRCm39) M790L possibly damaging Het
Zscan25 T C 5: 145,223,251 (GRCm39) L173P probably benign Het
Other mutations in Dusp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03181:Dusp7 APN 9 106,251,009 (GRCm39) missense probably damaging 1.00
alessi UTSW 9 106,250,940 (GRCm39) missense probably damaging 1.00
R1118:Dusp7 UTSW 9 106,250,849 (GRCm39) missense possibly damaging 0.91
R1952:Dusp7 UTSW 9 106,248,028 (GRCm39) missense probably benign 0.05
R2049:Dusp7 UTSW 9 106,251,096 (GRCm39) missense probably damaging 1.00
R2408:Dusp7 UTSW 9 106,246,361 (GRCm39) missense probably benign 0.30
R3852:Dusp7 UTSW 9 106,251,092 (GRCm39) missense probably benign 0.00
R4632:Dusp7 UTSW 9 106,247,965 (GRCm39) missense possibly damaging 0.64
R5022:Dusp7 UTSW 9 106,250,940 (GRCm39) missense probably damaging 1.00
R6273:Dusp7 UTSW 9 106,251,095 (GRCm39) missense possibly damaging 0.57
R6525:Dusp7 UTSW 9 106,246,483 (GRCm39) missense possibly damaging 0.91
R7575:Dusp7 UTSW 9 106,250,876 (GRCm39) missense probably damaging 1.00
R7818:Dusp7 UTSW 9 106,246,329 (GRCm39) missense probably benign 0.28
R7856:Dusp7 UTSW 9 106,246,067 (GRCm39) missense unknown
R8811:Dusp7 UTSW 9 106,248,241 (GRCm39) missense probably benign 0.04
R9126:Dusp7 UTSW 9 106,250,966 (GRCm39) missense
R9219:Dusp7 UTSW 9 106,248,212 (GRCm39) missense probably damaging 1.00
R9511:Dusp7 UTSW 9 106,248,125 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGGCACAGATGTAGGC -3'
(R):5'- TTGATGGCCGTCTCAATGTG -3'

Sequencing Primer
(F):5'- CCGGAGCCGCGGTTTAATTG -3'
(R):5'- GTCTCAATGTGCGACGATTC -3'
Posted On 2019-06-26