Mutagenetix > Incidental Mutation

Incidental Mutation 'R7161:Spef2'

557602

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

045260-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R7161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9717603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 219 (T219A)

Ref Sequence

ENSEMBL: ENSMUSP00000035762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]

AlphaFold

Q8C9J3

Predicted Effect

probably benign
Transcript: ENSMUST00000041840
AA Change: T219A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: T219A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159093
AA Change: T276A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: T276A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159368
AA Change: T219A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: T219A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	162	1.4e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160236
AA Change: T219A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: T219A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162780
AA Change: T276A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: T276A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	164	1.1e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: T219A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abca8a	T	A	11: 110,074,142	Q443L	probably benign	Het
Acad12	A	T	5: 121,607,373	M285K	probably damaging	Het
Afdn	T	A	17: 13,888,946	M1592K	possibly damaging	Het
Bpifb9b	A	T	2: 154,313,615	T345S	possibly damaging	Het
Bub1b	A	G	2: 118,626,053	E526G	probably damaging	Het
Car13	A	G	3: 14,645,208	D70G	probably benign	Het
Ccdc127	A	T	13: 74,352,877	L4F	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Ccr10	A	G	11: 101,174,278	I142T	probably benign	Het
Cep126	C	T	9: 8,087,399	V1005M	probably benign	Het
Chil6	A	G	3: 106,394,412	I124T	probably benign	Het
Coq8a	A	G	1: 180,170,341		probably null	Het
Ctf2	T	A	7: 127,719,304	K174N	probably damaging	Het
Dapk1	T	C	13: 60,696,395	V76A	possibly damaging	Het
Disp1	A	G	1: 183,087,625	M1077T	possibly damaging	Het
Dnah9	T	A	11: 65,855,372	K3972*	probably null	Het
Dusp7	T	A	9: 106,368,915	S40T	unknown	Het
Emg1	T	C	6: 124,705,749	T88A	probably benign	Het
Fbxo5	A	G	10: 5,802,043	V190A	possibly damaging	Het
Fbxw20	T	G	9: 109,225,980	D167A	probably damaging	Het
Fes	A	T	7: 80,380,861	V562E	probably damaging	Het
Foxj1	C	G	11: 116,332,408	G190R	probably damaging	Het
Gatsl2	C	A	5: 134,135,190	T75N	probably damaging	Het
Gdf15	T	G	8: 70,631,342	S91R	possibly damaging	Het
Gm4846	C	A	1: 166,487,010	V355F	probably damaging	Het
Herc4	T	A	10: 63,308,415	Y776N	probably benign	Het
Hspg2	G	A	4: 137,514,719	R588H	probably damaging	Het
Igkv6-25	T	A	6: 70,215,778	Y56*	probably null	Het
Itpr1	C	T	6: 108,386,640	A741V	probably damaging	Het
Kbtbd8	T	A	6: 95,126,696	I519K	probably benign	Het
Kcnh5	T	A	12: 74,897,709	Q922L	probably benign	Het
Kiss1r	T	C	10: 79,919,489	Y103H	probably damaging	Het
Knl1	A	G	2: 119,070,785	E989G	possibly damaging	Het
Lamc1	A	T	1: 153,226,454	L1466Q	probably damaging	Het
Lap3	C	T	5: 45,498,467	P138L	probably benign	Het
Lhx1	G	A	11: 84,519,872	P300S	probably damaging	Het
Mppe1	G	A	18: 67,229,771	A131V	probably benign	Het
Neb	A	T	2: 52,271,592	Y2063N	probably damaging	Het
Nfe2l1	A	G	11: 96,817,720	F740L	probably benign	Het
Nop10	A	G	2: 112,262,046	N8S	probably benign	Het
Olfr1097	A	C	2: 86,890,649	H175Q	probably benign	Het
Opalin	T	A	19: 41,069,935	T20S	possibly damaging	Het
Pask	C	T	1: 93,310,905	S1286N	probably benign	Het
Pcdhgc4	A	T	18: 37,815,663	E44V	probably damaging	Het
Pde1a	A	G	2: 79,865,214	M463T	probably benign	Het
Pde6a	A	T	18: 61,281,525	M714L	probably benign	Het
Pik3c2b	A	G	1: 133,106,112	E1618G	probably damaging	Het
Pou2f3	T	C	9: 43,139,363	N234S	probably damaging	Het
Ptprm	T	A	17: 66,809,627	T886S	probably benign	Het
Rab11fip3	C	A	17: 26,069,090	D30Y	probably benign	Het
Rassf10	A	T	7: 112,954,500	I103F	probably damaging	Het
Rfc4	A	G	16: 23,115,433	I206T	probably benign	Het
Rhcg	A	G	7: 79,617,441	F29S	probably damaging	Het
Sec11c	A	G	18: 65,812,732	I89V	probably benign	Het
Serac1	T	C	17: 6,065,076	D204G	probably damaging	Het
Serpinb3c	T	C	1: 107,273,162	N175S	probably null	Het
Slc25a19	C	T	11: 115,616,547	E250K	possibly damaging	Het
Slc9a8	A	T	2: 167,465,383	Y329F	possibly damaging	Het
Smagp	T	C	15: 100,636,245		probably benign	Het
Spats1	T	A	17: 45,449,169	Q268H	probably benign	Het
Spink13	A	G	18: 62,614,955	M11T	probably benign	Het
Susd1	T	C	4: 59,329,581	D669G	possibly damaging	Het
Svep1	A	G	4: 58,128,859	Y613H	possibly damaging	Het
Tcp10b	T	C	17: 13,081,746	*439Q	probably null	Het
Tmed2	T	A	5: 124,546,920	M133K	possibly damaging	Het
Trpv5	A	T	6: 41,660,536	Y370*	probably null	Het
Ttn	A	G	2: 76,812,244	S13316P	probably damaging	Het
Uap1l1	A	T	2: 25,363,280	M381K	probably damaging	Het
Wdr26	A	G	1: 181,203,130	Y200H	probably damaging	Het
Wdr78	G	A	4: 103,096,616	P129S	probably benign	Het
Zfhx4	A	T	3: 5,244,083	M790L	possibly damaging	Het
Zscan25	T	C	5: 145,286,441	L173P	probably benign	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
R8691:Spef2	UTSW	15	9601919	nonsense	probably null
R8751:Spef2	UTSW	15	9729637	nonsense	probably null
R8847:Spef2	UTSW	15	9668827	missense	probably benign
R8864:Spef2	UTSW	15	9599747	missense	unknown
R8868:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9725180	nonsense	probably null
R8935:Spef2	UTSW	15	9607350	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9647328	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9725177	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9601631	missense	unknown
R9076:Spef2	UTSW	15	9653005	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9601931	missense	unknown
R9216:Spef2	UTSW	15	9647525	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9578315	nonsense	probably null
R9278:Spef2	UTSW	15	9727409	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9389:Spef2	UTSW	15	9725221	missense	probably damaging	0.96
R9476:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9601799	missense	unknown
R9575:Spef2	UTSW	15	9596586	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9599811	missense	unknown
R9765:Spef2	UTSW	15	9601859	missense	unknown
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCACAGAGCTCACCTCCTG -3'
(R):5'- GCTATGCTAAGGATCTCAGAGGG -3'

Sequencing Primer
(F):5'- CCTGTGCTTCATGGGCCATTAG -3'
(R):5'- CTAAGGATCTCAGAGGGACAGATC -3'

Posted On

2019-06-26