Mutagenetix > Incidental Mutations

Incidental Mutation 'R7161:Rab11fip3'

557609

Institutional Source

Beutler Lab

Gene Symbol

Rab11fip3

Ensembl Gene

ENSMUSG00000037098

Gene Name

RAB11 family interacting protein 3 (class II)

Synonyms

D030060O14Rik, Rab11-FIP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25989036-26069409 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 26069090 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 30 (D30Y)

Ref Sequence

ENSEMBL: ENSMUSP00000113521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120691] [ENSMUST00000122103]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120691
AA Change: D30Y

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: D30Y

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	3.12e-31	PROSPERO
internal_repeat_1	144	294	3.12e-31	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	739	751	N/A	INTRINSIC
low complexity region	916	936	N/A	INTRINSIC
Blast:BRLZ	938	988	2e-11	BLAST
Pfam:RBD-FIP	1007	1047	4.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122103
AA Change: D30Y

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: D30Y

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	2.03e-32	PROSPERO
internal_repeat_1	144	294	2.03e-32	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	784	796	N/A	INTRINSIC
low complexity region	961	981	N/A	INTRINSIC
Blast:BRLZ	983	1033	2e-11	BLAST
Pfam:RBD-FIP	1052	1092	4.9e-18	PFAM

Meta Mutation Damage Score

0.1608

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abca8a	T	A	11: 110,074,142	Q443L	probably benign	Het
Acad12	A	T	5: 121,607,373	M285K	probably damaging	Het
Afdn	T	A	17: 13,888,946	M1592K	possibly damaging	Het
Bpifb9b	A	T	2: 154,313,615	T345S	possibly damaging	Het
Bub1b	A	G	2: 118,626,053	E526G	probably damaging	Het
Car13	A	G	3: 14,645,208	D70G	probably benign	Het
Ccdc127	A	T	13: 74,352,877	L4F	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Ccr10	A	G	11: 101,174,278	I142T	probably benign	Het
Cep126	C	T	9: 8,087,399	V1005M	probably benign	Het
Chil6	A	G	3: 106,394,412	I124T	probably benign	Het
Coq8a	A	G	1: 180,170,341		probably null	Het
Ctf2	T	A	7: 127,719,304	K174N	probably damaging	Het
Dapk1	T	C	13: 60,696,395	V76A	possibly damaging	Het
Disp1	A	G	1: 183,087,625	M1077T	possibly damaging	Het
Dnah9	T	A	11: 65,855,372	K3972*	probably null	Het
Dusp7	T	A	9: 106,368,915	S40T	unknown	Het
Emg1	T	C	6: 124,705,749	T88A	probably benign	Het
Fbxo5	A	G	10: 5,802,043	V190A	possibly damaging	Het
Fbxw20	T	G	9: 109,225,980	D167A	probably damaging	Het
Fes	A	T	7: 80,380,861	V562E	probably damaging	Het
Foxj1	C	G	11: 116,332,408	G190R	probably damaging	Het
Gatsl2	C	A	5: 134,135,190	T75N	probably damaging	Het
Gdf15	T	G	8: 70,631,342	S91R	possibly damaging	Het
Gm4846	C	A	1: 166,487,010	V355F	probably damaging	Het
Herc4	T	A	10: 63,308,415	Y776N	probably benign	Het
Hspg2	G	A	4: 137,514,719	R588H	probably damaging	Het
Igkv6-25	T	A	6: 70,215,778	Y56*	probably null	Het
Itpr1	C	T	6: 108,386,640	A741V	probably damaging	Het
Kbtbd8	T	A	6: 95,126,696	I519K	probably benign	Het
Kcnh5	T	A	12: 74,897,709	Q922L	probably benign	Het
Kiss1r	T	C	10: 79,919,489	Y103H	probably damaging	Het
Knl1	A	G	2: 119,070,785	E989G	possibly damaging	Het
Lamc1	A	T	1: 153,226,454	L1466Q	probably damaging	Het
Lap3	C	T	5: 45,498,467	P138L	probably benign	Het
Lhx1	G	A	11: 84,519,872	P300S	probably damaging	Het
Mppe1	G	A	18: 67,229,771	A131V	probably benign	Het
Neb	A	T	2: 52,271,592	Y2063N	probably damaging	Het
Nfe2l1	A	G	11: 96,817,720	F740L	probably benign	Het
Nop10	A	G	2: 112,262,046	N8S	probably benign	Het
Olfr1097	A	C	2: 86,890,649	H175Q	probably benign	Het
Opalin	T	A	19: 41,069,935	T20S	possibly damaging	Het
Pask	C	T	1: 93,310,905	S1286N	probably benign	Het
Pcdhgc4	A	T	18: 37,815,663	E44V	probably damaging	Het
Pde1a	A	G	2: 79,865,214	M463T	probably benign	Het
Pde6a	A	T	18: 61,281,525	M714L	probably benign	Het
Pik3c2b	A	G	1: 133,106,112	E1618G	probably damaging	Het
Pou2f3	T	C	9: 43,139,363	N234S	probably damaging	Het
Ptprm	T	A	17: 66,809,627	T886S	probably benign	Het
Rassf10	A	T	7: 112,954,500	I103F	probably damaging	Het
Rfc4	A	G	16: 23,115,433	I206T	probably benign	Het
Rhcg	A	G	7: 79,617,441	F29S	probably damaging	Het
Sec11c	A	G	18: 65,812,732	I89V	probably benign	Het
Serac1	T	C	17: 6,065,076	D204G	probably damaging	Het
Serpinb3c	T	C	1: 107,273,162	N175S	probably null	Het
Slc25a19	C	T	11: 115,616,547	E250K	possibly damaging	Het
Slc9a8	A	T	2: 167,465,383	Y329F	possibly damaging	Het
Smagp	T	C	15: 100,636,245		probably benign	Het
Spats1	T	A	17: 45,449,169	Q268H	probably benign	Het
Spef2	T	C	15: 9,717,603	T219A	probably benign	Het
Spink13	A	G	18: 62,614,955	M11T	probably benign	Het
Susd1	T	C	4: 59,329,581	D669G	possibly damaging	Het
Svep1	A	G	4: 58,128,859	Y613H	possibly damaging	Het
Tcp10b	T	C	17: 13,081,746	*439Q	probably null	Het
Tmed2	T	A	5: 124,546,920	M133K	possibly damaging	Het
Trpv5	A	T	6: 41,660,536	Y370*	probably null	Het
Ttn	A	G	2: 76,812,244	S13316P	probably damaging	Het
Uap1l1	A	T	2: 25,363,280	M381K	probably damaging	Het
Wdr26	A	G	1: 181,203,130	Y200H	probably damaging	Het
Wdr78	G	A	4: 103,096,616	P129S	probably benign	Het
Zfhx4	A	T	3: 5,244,083	M790L	possibly damaging	Het
Zscan25	T	C	5: 145,286,441	L173P	probably benign	Het

Other mutations in Rab11fip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rab11fip3	APN	17	25991809	splice site	probably benign
IGL00420:Rab11fip3	APN	17	26067625	missense	probably benign	0.20
IGL01291:Rab11fip3	APN	17	26016113	missense	probably damaging	0.99
IGL01473:Rab11fip3	APN	17	26068735	missense	possibly damaging	0.53
IGL01687:Rab11fip3	APN	17	26067982	missense	probably damaging	0.97
IGL01764:Rab11fip3	APN	17	26068693	missense	probably benign	0.02
IGL01977:Rab11fip3	APN	17	26068003	missense	possibly damaging	0.72
IGL02140:Rab11fip3	APN	17	26067892	missense	probably benign	0.33
IGL02434:Rab11fip3	APN	17	26068835	missense	possibly damaging	0.85
IGL02549:Rab11fip3	APN	17	25994320	missense	probably damaging	0.96
IGL02889:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
IGL02953:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
ANU05:Rab11fip3	UTSW	17	26016113	missense	probably damaging	0.99
R0193:Rab11fip3	UTSW	17	25990999	missense	probably damaging	0.99
R0388:Rab11fip3	UTSW	17	26069072	missense	probably benign	0.33
R0543:Rab11fip3	UTSW	17	25994225	missense	probably damaging	1.00
R0678:Rab11fip3	UTSW	17	26068847	missense	probably benign	0.00
R1283:Rab11fip3	UTSW	17	26004554	missense	probably damaging	1.00
R1473:Rab11fip3	UTSW	17	25991322	missense	probably damaging	1.00
R1625:Rab11fip3	UTSW	17	26068891	missense	possibly damaging	0.72
R1973:Rab11fip3	UTSW	17	26024391	missense	probably damaging	0.97
R2160:Rab11fip3	UTSW	17	26069054	missense	probably benign	0.33
R2197:Rab11fip3	UTSW	17	26068178	missense	probably benign
R2382:Rab11fip3	UTSW	17	25990867	nonsense	probably null
R3028:Rab11fip3	UTSW	17	26015942	critical splice donor site	probably null
R3797:Rab11fip3	UTSW	17	26068526	missense	possibly damaging	0.73
R4012:Rab11fip3	UTSW	17	26068028	frame shift	probably null
R4064:Rab11fip3	UTSW	17	26024394	missense	probably damaging	0.97
R4478:Rab11fip3	UTSW	17	26016083	missense	probably damaging	1.00
R4527:Rab11fip3	UTSW	17	26036657	missense	probably damaging	1.00
R4565:Rab11fip3	UTSW	17	26068706	missense	possibly damaging	0.73
R5048:Rab11fip3	UTSW	17	26067580	critical splice donor site	probably null
R5138:Rab11fip3	UTSW	17	25991026	missense	probably benign	0.32
R5317:Rab11fip3	UTSW	17	26068078	missense	possibly damaging	0.72
R5453:Rab11fip3	UTSW	17	25992581	critical splice donor site	probably null
R5495:Rab11fip3	UTSW	17	26016143	missense	probably damaging	0.99
R5525:Rab11fip3	UTSW	17	25991295	missense	probably damaging	1.00
R5654:Rab11fip3	UTSW	17	26016064	missense	probably damaging	1.00
R5716:Rab11fip3	UTSW	17	26036664	missense	probably damaging	1.00
R5818:Rab11fip3	UTSW	17	26016116	missense	probably damaging	1.00
R6044:Rab11fip3	UTSW	17	26067869	missense	possibly damaging	0.93
R6716:Rab11fip3	UTSW	17	25991057	missense	probably damaging	1.00
R6785:Rab11fip3	UTSW	17	25991718	missense	probably damaging	0.99
R7390:Rab11fip3	UTSW	17	26068152	missense	possibly damaging	0.81
R7447:Rab11fip3	UTSW	17	26068874	missense	possibly damaging	0.66
R7836:Rab11fip3	UTSW	17	26068258	missense	possibly damaging	0.82
R7981:Rab11fip3	UTSW	17	25997989	missense	probably damaging	0.98
R8008:Rab11fip3	UTSW	17	26067982	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AAGTGACAGGATTCATCGGG -3'
(R):5'- TTACATCATCCGGACTGTGCC -3'

Sequencing Primer
(F):5'- ACAGGATTCATCGGGCTCCTG -3'
(R):5'- ACTGTGCCGCTGCCATG -3'

Posted On

2019-06-26