Mutagenetix > Incidental Mutation

Incidental Mutation 'R7161:Ptprm'

557611

Institutional Source

Beutler Lab

Gene Symbol

Ptprm

Ensembl Gene

ENSMUSG00000033278

Gene Name

protein tyrosine phosphatase, receptor type, M

Synonyms

RPTPmu

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66666947-67354457 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66809627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 886 (T886S)

Ref Sequence

ENSEMBL: ENSMUSP00000045603 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091]

AlphaFold

P28828

Predicted Effect

probably benign
Transcript: ENSMUST00000037974
AA Change: T886S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: T886S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
MAM	22	184	2.81e-73	SMART
IG	191	279	2.1e-6	SMART
FN3	281	364	6.35e-4	SMART
FN3	380	468	2.81e-5	SMART
FN3	482	572	3.7e-5	SMART
transmembrane domain	743	764	N/A	INTRINSIC
low complexity region	765	774	N/A	INTRINSIC
PTPc	899	1156	5.26e-135	SMART
PTPc	1185	1450	9.46e-96	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223982
AA Change: T852S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224091
AA Change: T877S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000225554

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abca8a	T	A	11: 110,074,142	Q443L	probably benign	Het
Acad12	A	T	5: 121,607,373	M285K	probably damaging	Het
Afdn	T	A	17: 13,888,946	M1592K	possibly damaging	Het
Bpifb9b	A	T	2: 154,313,615	T345S	possibly damaging	Het
Bub1b	A	G	2: 118,626,053	E526G	probably damaging	Het
Car13	A	G	3: 14,645,208	D70G	probably benign	Het
Ccdc127	A	T	13: 74,352,877	L4F	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Ccr10	A	G	11: 101,174,278	I142T	probably benign	Het
Cep126	C	T	9: 8,087,399	V1005M	probably benign	Het
Chil6	A	G	3: 106,394,412	I124T	probably benign	Het
Coq8a	A	G	1: 180,170,341		probably null	Het
Ctf2	T	A	7: 127,719,304	K174N	probably damaging	Het
Dapk1	T	C	13: 60,696,395	V76A	possibly damaging	Het
Disp1	A	G	1: 183,087,625	M1077T	possibly damaging	Het
Dnah9	T	A	11: 65,855,372	K3972*	probably null	Het
Dusp7	T	A	9: 106,368,915	S40T	unknown	Het
Emg1	T	C	6: 124,705,749	T88A	probably benign	Het
Fbxo5	A	G	10: 5,802,043	V190A	possibly damaging	Het
Fbxw20	T	G	9: 109,225,980	D167A	probably damaging	Het
Fes	A	T	7: 80,380,861	V562E	probably damaging	Het
Foxj1	C	G	11: 116,332,408	G190R	probably damaging	Het
Gatsl2	C	A	5: 134,135,190	T75N	probably damaging	Het
Gdf15	T	G	8: 70,631,342	S91R	possibly damaging	Het
Gm4846	C	A	1: 166,487,010	V355F	probably damaging	Het
Herc4	T	A	10: 63,308,415	Y776N	probably benign	Het
Hspg2	G	A	4: 137,514,719	R588H	probably damaging	Het
Igkv6-25	T	A	6: 70,215,778	Y56*	probably null	Het
Itpr1	C	T	6: 108,386,640	A741V	probably damaging	Het
Kbtbd8	T	A	6: 95,126,696	I519K	probably benign	Het
Kcnh5	T	A	12: 74,897,709	Q922L	probably benign	Het
Kiss1r	T	C	10: 79,919,489	Y103H	probably damaging	Het
Knl1	A	G	2: 119,070,785	E989G	possibly damaging	Het
Lamc1	A	T	1: 153,226,454	L1466Q	probably damaging	Het
Lap3	C	T	5: 45,498,467	P138L	probably benign	Het
Lhx1	G	A	11: 84,519,872	P300S	probably damaging	Het
Mppe1	G	A	18: 67,229,771	A131V	probably benign	Het
Neb	A	T	2: 52,271,592	Y2063N	probably damaging	Het
Nfe2l1	A	G	11: 96,817,720	F740L	probably benign	Het
Nop10	A	G	2: 112,262,046	N8S	probably benign	Het
Olfr1097	A	C	2: 86,890,649	H175Q	probably benign	Het
Opalin	T	A	19: 41,069,935	T20S	possibly damaging	Het
Pask	C	T	1: 93,310,905	S1286N	probably benign	Het
Pcdhgc4	A	T	18: 37,815,663	E44V	probably damaging	Het
Pde1a	A	G	2: 79,865,214	M463T	probably benign	Het
Pde6a	A	T	18: 61,281,525	M714L	probably benign	Het
Pik3c2b	A	G	1: 133,106,112	E1618G	probably damaging	Het
Pou2f3	T	C	9: 43,139,363	N234S	probably damaging	Het
Rab11fip3	C	A	17: 26,069,090	D30Y	probably benign	Het
Rassf10	A	T	7: 112,954,500	I103F	probably damaging	Het
Rfc4	A	G	16: 23,115,433	I206T	probably benign	Het
Rhcg	A	G	7: 79,617,441	F29S	probably damaging	Het
Sec11c	A	G	18: 65,812,732	I89V	probably benign	Het
Serac1	T	C	17: 6,065,076	D204G	probably damaging	Het
Serpinb3c	T	C	1: 107,273,162	N175S	probably null	Het
Slc25a19	C	T	11: 115,616,547	E250K	possibly damaging	Het
Slc9a8	A	T	2: 167,465,383	Y329F	possibly damaging	Het
Smagp	T	C	15: 100,636,245		probably benign	Het
Spats1	T	A	17: 45,449,169	Q268H	probably benign	Het
Spef2	T	C	15: 9,717,603	T219A	probably benign	Het
Spink13	A	G	18: 62,614,955	M11T	probably benign	Het
Susd1	T	C	4: 59,329,581	D669G	possibly damaging	Het
Svep1	A	G	4: 58,128,859	Y613H	possibly damaging	Het
Tcp10b	T	C	17: 13,081,746	*439Q	probably null	Het
Tmed2	T	A	5: 124,546,920	M133K	possibly damaging	Het
Trpv5	A	T	6: 41,660,536	Y370*	probably null	Het
Ttn	A	G	2: 76,812,244	S13316P	probably damaging	Het
Uap1l1	A	T	2: 25,363,280	M381K	probably damaging	Het
Wdr26	A	G	1: 181,203,130	Y200H	probably damaging	Het
Wdr78	G	A	4: 103,096,616	P129S	probably benign	Het
Zfhx4	A	T	3: 5,244,083	M790L	possibly damaging	Het
Zscan25	T	C	5: 145,286,441	L173P	probably benign	Het

Other mutations in Ptprm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Ptprm	APN	17	66817972	missense	probably damaging	1.00
IGL01128:Ptprm	APN	17	67042101	missense	probably damaging	1.00
IGL01509:Ptprm	APN	17	66762213	missense	possibly damaging	0.95
IGL01785:Ptprm	APN	17	66685623	missense	probably damaging	1.00
IGL01912:Ptprm	APN	17	67046118	missense	probably benign	0.13
IGL01929:Ptprm	APN	17	66690549	missense	probably damaging	1.00
IGL01937:Ptprm	APN	17	67046163	splice site	probably benign
IGL01939:Ptprm	APN	17	67063163	splice site	probably benign
IGL02053:Ptprm	APN	17	66693841	missense	probably damaging	1.00
IGL02203:Ptprm	APN	17	66953123	missense	probably damaging	1.00
IGL02468:Ptprm	APN	17	66814509	missense	probably benign	0.02
IGL02500:Ptprm	APN	17	66920048	missense	probably damaging	0.99
IGL02542:Ptprm	APN	17	66920150	missense	probably benign
Becalming	UTSW	17	66944332	splice site	probably null
Pacifying	UTSW	17	66683408	missense	possibly damaging	0.74
R0674:Ptprm	UTSW	17	67191341	missense	possibly damaging	0.52
R0709:Ptprm	UTSW	17	66944332	splice site	probably null
R1054:Ptprm	UTSW	17	67042318	missense	probably damaging	1.00
R1522:Ptprm	UTSW	17	66693871	missense	possibly damaging	0.91
R1561:Ptprm	UTSW	17	66940541	missense	probably damaging	1.00
R1726:Ptprm	UTSW	17	67042327	missense	probably damaging	1.00
R1744:Ptprm	UTSW	17	66689366	missense	probably damaging	1.00
R1873:Ptprm	UTSW	17	66688355	missense	probably damaging	1.00
R1951:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1952:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1953:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1993:Ptprm	UTSW	17	66747160	missense	probably damaging	1.00
R2017:Ptprm	UTSW	17	66957153	splice site	probably null
R2266:Ptprm	UTSW	17	66725851	splice site	probably null
R2417:Ptprm	UTSW	17	66944326	missense	probably damaging	0.97
R2511:Ptprm	UTSW	17	66693778	missense	probably damaging	1.00
R3726:Ptprm	UTSW	17	66956860	missense	possibly damaging	0.91
R3824:Ptprm	UTSW	17	66809575	missense	probably benign	0.40
R4057:Ptprm	UTSW	17	67075663	missense	possibly damaging	0.93
R4113:Ptprm	UTSW	17	66725813	missense	probably damaging	1.00
R4559:Ptprm	UTSW	17	66683408	missense	possibly damaging	0.74
R4598:Ptprm	UTSW	17	67095497	missense	probably benign	0.00
R4742:Ptprm	UTSW	17	66744751	nonsense	probably null
R4974:Ptprm	UTSW	17	66678067	missense	probably benign	0.01
R5157:Ptprm	UTSW	17	66957097	missense	probably benign	0.09
R5433:Ptprm	UTSW	17	66693473	missense	probably damaging	1.00
R5509:Ptprm	UTSW	17	66689358	missense	probably damaging	1.00
R5586:Ptprm	UTSW	17	66920196	missense	probably damaging	1.00
R5820:Ptprm	UTSW	17	66689465	missense	probably damaging	1.00
R5867:Ptprm	UTSW	17	67045981	splice site	probably null
R6044:Ptprm	UTSW	17	66693862	missense	probably damaging	1.00
R6229:Ptprm	UTSW	17	66688300	missense	probably damaging	1.00
R6615:Ptprm	UTSW	17	67353956	critical splice donor site	probably null
R6969:Ptprm	UTSW	17	66912418	missense	possibly damaging	0.63
R7135:Ptprm	UTSW	17	66944288	missense	possibly damaging	0.93
R7410:Ptprm	UTSW	17	66693566	missense	probably damaging	0.99
R7476:Ptprm	UTSW	17	66725791	missense	probably benign	0.01
R7789:Ptprm	UTSW	17	67095539	missense	probably damaging	1.00
R8027:Ptprm	UTSW	17	66944205	missense	probably damaging	1.00
R8089:Ptprm	UTSW	17	66683488	missense	possibly damaging	0.63
R8442:Ptprm	UTSW	17	66944317	missense	possibly damaging	0.70
R8476:Ptprm	UTSW	17	66944322	missense	probably damaging	1.00
R8866:Ptprm	UTSW	17	66809635	missense	probably benign	0.00
R8907:Ptprm	UTSW	17	66744737	missense	probably damaging	0.99
R8930:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R8932:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R9009:Ptprm	UTSW	17	66689359	missense	probably damaging	1.00
R9084:Ptprm	UTSW	17	66956953	missense	possibly damaging	0.93
R9338:Ptprm	UTSW	17	66762148	missense	probably damaging	1.00
R9514:Ptprm	UTSW	17	66809471	missense	probably damaging	1.00
R9610:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9611:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9620:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00
R9663:Ptprm	UTSW	17	67191296	missense	probably benign	0.34
R9694:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00
R9736:Ptprm	UTSW	17	66690567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAACATGCAGCCAGCCAG -3'
(R):5'- GCAATATCTCGTTTGGACTGC -3'

Sequencing Primer
(F):5'- CCAGCTGCTGGCCCAGG -3'
(R):5'- ATCTCGTTTGGACTGCTTTGTAAAAG -3'

Posted On

2019-06-26