Incidental Mutation 'R7162:Plb1'
ID557640
Institutional Source Beutler Lab
Gene Symbol Plb1
Ensembl Gene ENSMUSG00000029134
Gene Namephospholipase B1
Synonyms4930539A06Rik, 4632413E21Rik, 4930433E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7162 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32232708-32366520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32349663 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1194 (K1194R)
Ref Sequence ENSEMBL: ENSMUSP00000098927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]
Predicted Effect probably benign
Transcript: ENSMUST00000101376
AA Change: K1194R

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: K1194R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202220
AA Change: K1194R

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: K1194R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 C T 1: 87,127,749 T506I unknown Het
Ank1 T C 8: 23,132,354 W1640R possibly damaging Het
Atp2a2 A G 5: 122,489,324 M126T probably benign Het
Bptf A T 11: 107,043,631 probably null Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
Cables1 T C 18: 11,926,366 probably null Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Cacna1b A C 2: 24,700,022 I558S probably benign Het
Ccdc166 A G 15: 75,981,195 S308P probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfhr2 A G 1: 139,813,526 V237A probably benign Het
Clybl C A 14: 122,371,320 S108* probably null Het
Cubn A G 2: 13,342,498 Y2070H probably damaging Het
Cyp8b1 A G 9: 121,915,711 F185S probably damaging Het
Dennd2c T A 3: 103,156,107 V620D probably damaging Het
Dis3l2 T C 1: 87,044,030 F597L possibly damaging Het
Eif3f G A 7: 108,940,731 R282H probably benign Het
Ell C A 8: 70,578,909 R86S possibly damaging Het
Eppk1 A G 15: 76,106,609 V2024A possibly damaging Het
Exoc6 T C 19: 37,577,118 I214T probably damaging Het
Faim2 A G 15: 99,521,167 probably null Het
Gli1 A G 10: 127,332,437 S516P probably benign Het
Gm18596 A T 10: 77,742,200 S147T unknown Het
Gm19965 A G 1: 116,822,365 Y592C unknown Het
Gng12 T C 6: 67,017,301 S36P unknown Het
Gramd3 G A 18: 56,485,457 probably null Het
Hmcn1 T A 1: 150,748,993 T1054S probably benign Het
Ifngr1 A G 10: 19,609,353 T367A probably benign Het
Il21r G T 7: 125,632,311 V304L probably benign Het
Ino80d G A 1: 63,065,735 T394M probably damaging Het
Itfg2 C T 6: 128,410,583 V380M probably damaging Het
Kcna5 C T 6: 126,533,843 V441I possibly damaging Het
Kcp T A 6: 29,497,200 probably null Het
Kdf1 C T 4: 133,529,918 T375I unknown Het
Klk1b1 A T 7: 43,969,247 D16V probably damaging Het
Krtap5-4 A C 7: 142,303,598 T2P unknown Het
Lamtor1 A G 7: 101,906,036 D13G probably benign Het
Lrp10 T C 14: 54,465,706 V72A possibly damaging Het
Lrrc1 C A 9: 77,432,190 A503S probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Myo5b C G 18: 74,695,427 L717V probably benign Het
Myoz3 T A 18: 60,576,413 R225S probably damaging Het
Myrf A G 19: 10,218,646 F335L possibly damaging Het
Nfib A C 4: 82,350,440 S292A probably damaging Het
Notch3 G T 17: 32,146,449 H1096Q probably damaging Het
Nt5c1a A G 4: 123,214,105 R194G probably benign Het
Olfr76 A G 19: 12,120,137 F192L possibly damaging Het
Olfr958 A G 9: 39,550,229 I214T probably damaging Het
Parp4 A G 14: 56,648,876 E1804G unknown Het
Pcdhac2 A T 18: 37,145,787 I607L probably benign Het
Pcdhb5 A G 18: 37,321,686 D373G probably benign Het
Pcf11 A T 7: 92,664,013 V154E probably damaging Het
Pdia3 T G 2: 121,429,521 D180E probably benign Het
Piezo2 C A 18: 63,124,709 V313F possibly damaging Het
Pik3ap1 C A 19: 41,321,526 A452S probably benign Het
Pld3 A C 7: 27,532,474 W431G probably damaging Het
Plekha3 T C 2: 76,692,766 probably null Het
Ppm1f G T 16: 16,914,193 R169L probably damaging Het
Ppp2r3d A G 9: 124,439,673 V60A Het
Prop1 T A 11: 50,952,054 D102V probably damaging Het
Rbm27 G A 18: 42,314,027 G446R unknown Het
Rc3h2 C A 2: 37,409,605 V138L possibly damaging Het
Rorc G A 3: 94,377,608 probably null Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sart3 A G 5: 113,762,835 Y181H probably damaging Het
Sbpl A T 17: 23,953,465 M160K possibly damaging Het
Sh3gl3 A G 7: 82,284,142 S238G probably benign Het
Slc22a30 A G 19: 8,336,717 probably null Het
Slc3a1 A T 17: 85,064,014 R665* probably null Het
Stk32a C A 18: 43,297,584 Y186* probably null Het
Stxbp6 T C 12: 44,902,880 N89D probably benign Het
Svep1 A G 4: 58,070,262 F2508S possibly damaging Het
Tas1r1 A G 4: 152,032,238 V313A possibly damaging Het
Tmem81 T C 1: 132,507,617 Y54H probably damaging Het
Tmtc1 T C 6: 148,271,487 N582S probably damaging Het
Top2b T C 14: 16,416,653 S1138P probably benign Het
Trim24 T A 6: 37,965,521 N989K possibly damaging Het
Trim72 T A 7: 128,007,649 M145K probably benign Het
Ttll9 T A 2: 152,989,603 S154T probably damaging Het
Tusc3 T C 8: 39,126,587 V286A probably benign Het
Vat1l C A 8: 114,236,778 H185N probably damaging Het
Vmn1r209 A T 13: 22,805,958 D187E probably damaging Het
Vmn2r87 T C 10: 130,477,547 N450S probably benign Het
Wdr7 T A 18: 63,724,139 D95E possibly damaging Het
Zfp937 C T 2: 150,239,519 H490Y probably benign Het
Zfp974 A T 7: 27,911,519 H260Q possibly damaging Het
Other mutations in Plb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Plb1 APN 5 32345736 missense probably benign 0.00
IGL00542:Plb1 APN 5 32269834 missense probably benign 0.02
IGL00835:Plb1 APN 5 32364172 missense unknown
IGL00954:Plb1 APN 5 32298514 splice site probably benign
IGL01350:Plb1 APN 5 32317064 missense probably damaging 1.00
IGL01527:Plb1 APN 5 32317123 missense probably damaging 1.00
IGL01599:Plb1 APN 5 32342544 splice site probably benign
IGL01690:Plb1 APN 5 32313697 missense probably damaging 1.00
IGL01813:Plb1 APN 5 32329085 missense probably damaging 1.00
IGL01826:Plb1 APN 5 32281145 missense probably damaging 0.99
IGL02263:Plb1 APN 5 32321348 splice site probably benign
IGL02314:Plb1 APN 5 32281148 missense possibly damaging 0.93
IGL02649:Plb1 APN 5 32362568 missense probably benign 0.09
IGL02701:Plb1 APN 5 32364197 missense unknown
IGL02704:Plb1 APN 5 32353667 missense probably benign 0.03
IGL03170:Plb1 APN 5 32284902 missense probably damaging 0.99
IGL03182:Plb1 APN 5 32344915 splice site probably benign
IGL03326:Plb1 APN 5 32331327 missense probably benign 0.00
IGL03046:Plb1 UTSW 5 32328412 missense probably damaging 1.00
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0330:Plb1 UTSW 5 32355357 missense probably damaging 1.00
R0413:Plb1 UTSW 5 32355362 missense probably damaging 1.00
R0721:Plb1 UTSW 5 32364195 missense unknown
R0735:Plb1 UTSW 5 32284920 missense possibly damaging 0.90
R1423:Plb1 UTSW 5 32293257 missense probably benign
R1428:Plb1 UTSW 5 32264912 missense possibly damaging 0.82
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1694:Plb1 UTSW 5 32317277 missense probably null 0.01
R1801:Plb1 UTSW 5 32293243 missense probably damaging 1.00
R1804:Plb1 UTSW 5 32353697 missense possibly damaging 0.91
R1900:Plb1 UTSW 5 32286847 missense probably benign 0.44
R1903:Plb1 UTSW 5 32291238 missense probably damaging 1.00
R2101:Plb1 UTSW 5 32349660 missense probably damaging 1.00
R2153:Plb1 UTSW 5 32314089 missense probably damaging 1.00
R2207:Plb1 UTSW 5 32316640 missense possibly damaging 0.50
R2270:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2271:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2311:Plb1 UTSW 5 32269818 missense probably benign 0.01
R2850:Plb1 UTSW 5 32293224 missense probably benign
R3103:Plb1 UTSW 5 32328029 missense possibly damaging 0.92
R4444:Plb1 UTSW 5 32330565 missense probably benign 0.06
R4559:Plb1 UTSW 5 32332831 missense probably damaging 0.99
R4577:Plb1 UTSW 5 32247557 nonsense probably null
R4578:Plb1 UTSW 5 32247557 nonsense probably null
R4739:Plb1 UTSW 5 32349679 splice site probably null
R4747:Plb1 UTSW 5 32349659 missense probably benign 0.08
R4806:Plb1 UTSW 5 32289852 missense probably damaging 1.00
R5406:Plb1 UTSW 5 32341915 missense probably damaging 1.00
R5567:Plb1 UTSW 5 32364199 missense unknown
R5574:Plb1 UTSW 5 32329947 missense probably benign 0.13
R5588:Plb1 UTSW 5 32329949 critical splice donor site probably null
R5619:Plb1 UTSW 5 32333497 missense probably damaging 0.99
R5769:Plb1 UTSW 5 32317522 missense probably benign 0.05
R6366:Plb1 UTSW 5 32314085 missense possibly damaging 0.59
R6700:Plb1 UTSW 5 32333464 missense probably damaging 0.99
R7379:Plb1 UTSW 5 32345639 missense probably damaging 1.00
R7395:Plb1 UTSW 5 32353684 missense probably benign 0.30
R7426:Plb1 UTSW 5 32321247 splice site probably null
R7643:Plb1 UTSW 5 32247557 nonsense probably null
R7657:Plb1 UTSW 5 32329867 missense probably damaging 0.98
R7780:Plb1 UTSW 5 32326266 splice site probably null
R8040:Plb1 UTSW 5 32273069 missense possibly damaging 0.89
R8212:Plb1 UTSW 5 32264906 missense probably damaging 1.00
R8312:Plb1 UTSW 5 32328485 missense probably damaging 1.00
X0018:Plb1 UTSW 5 32285883 missense probably benign 0.01
X0019:Plb1 UTSW 5 32353697 missense probably damaging 0.99
X0027:Plb1 UTSW 5 32270358 missense probably benign
X0028:Plb1 UTSW 5 32302675 missense probably damaging 1.00
Z1088:Plb1 UTSW 5 32310917 missense probably benign
Z1088:Plb1 UTSW 5 32310847 missense probably damaging 0.99
Z1177:Plb1 UTSW 5 32284897 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAAGACTCAGATCCTGCCCCAG -3'
(R):5'- CTGTGATCTTGGCCAACTCC -3'

Sequencing Primer
(F):5'- TCTGGATAGGTGTAGCCCC -3'
(R):5'- GTGATCTTGGCCAACTCCTCATTC -3'
Posted On2019-06-26