Incidental Mutation 'R7162:Notch3'
ID557686
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7162 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32146449 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1096 (H1096Q)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably damaging
Transcript: ENSMUST00000087723
AA Change: H1096Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: H1096Q

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 C T 1: 87,127,749 T506I unknown Het
Ank1 T C 8: 23,132,354 W1640R possibly damaging Het
Atp2a2 A G 5: 122,489,324 M126T probably benign Het
Bptf A T 11: 107,043,631 probably null Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
Cables1 T C 18: 11,926,366 probably null Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Cacna1b A C 2: 24,700,022 I558S probably benign Het
Ccdc166 A G 15: 75,981,195 S308P probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cfhr2 A G 1: 139,813,526 V237A probably benign Het
Clybl C A 14: 122,371,320 S108* probably null Het
Cubn A G 2: 13,342,498 Y2070H probably damaging Het
Cyp8b1 A G 9: 121,915,711 F185S probably damaging Het
Dennd2c T A 3: 103,156,107 V620D probably damaging Het
Dis3l2 T C 1: 87,044,030 F597L possibly damaging Het
Eif3f G A 7: 108,940,731 R282H probably benign Het
Ell C A 8: 70,578,909 R86S possibly damaging Het
Eppk1 A G 15: 76,106,609 V2024A possibly damaging Het
Exoc6 T C 19: 37,577,118 I214T probably damaging Het
Faim2 A G 15: 99,521,167 probably null Het
Gli1 A G 10: 127,332,437 S516P probably benign Het
Gm18596 A T 10: 77,742,200 S147T unknown Het
Gm19965 A G 1: 116,822,365 Y592C unknown Het
Gng12 T C 6: 67,017,301 S36P unknown Het
Gramd3 G A 18: 56,485,457 probably null Het
Hmcn1 T A 1: 150,748,993 T1054S probably benign Het
Ifngr1 A G 10: 19,609,353 T367A probably benign Het
Il21r G T 7: 125,632,311 V304L probably benign Het
Ino80d G A 1: 63,065,735 T394M probably damaging Het
Itfg2 C T 6: 128,410,583 V380M probably damaging Het
Kcna5 C T 6: 126,533,843 V441I possibly damaging Het
Kcp T A 6: 29,497,200 probably null Het
Kdf1 C T 4: 133,529,918 T375I unknown Het
Klk1b1 A T 7: 43,969,247 D16V probably damaging Het
Krtap5-4 A C 7: 142,303,598 T2P unknown Het
Lamtor1 A G 7: 101,906,036 D13G probably benign Het
Lrp10 T C 14: 54,465,706 V72A possibly damaging Het
Lrrc1 C A 9: 77,432,190 A503S probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Myo5b C G 18: 74,695,427 L717V probably benign Het
Myoz3 T A 18: 60,576,413 R225S probably damaging Het
Myrf A G 19: 10,218,646 F335L possibly damaging Het
Nfib A C 4: 82,350,440 S292A probably damaging Het
Nt5c1a A G 4: 123,214,105 R194G probably benign Het
Olfr76 A G 19: 12,120,137 F192L possibly damaging Het
Olfr958 A G 9: 39,550,229 I214T probably damaging Het
Parp4 A G 14: 56,648,876 E1804G unknown Het
Pcdhac2 A T 18: 37,145,787 I607L probably benign Het
Pcdhb5 A G 18: 37,321,686 D373G probably benign Het
Pcf11 A T 7: 92,664,013 V154E probably damaging Het
Pdia3 T G 2: 121,429,521 D180E probably benign Het
Piezo2 C A 18: 63,124,709 V313F possibly damaging Het
Pik3ap1 C A 19: 41,321,526 A452S probably benign Het
Plb1 A G 5: 32,349,663 K1194R probably benign Het
Pld3 A C 7: 27,532,474 W431G probably damaging Het
Plekha3 T C 2: 76,692,766 probably null Het
Ppm1f G T 16: 16,914,193 R169L probably damaging Het
Ppp2r3d A G 9: 124,439,673 V60A Het
Prop1 T A 11: 50,952,054 D102V probably damaging Het
Rbm27 G A 18: 42,314,027 G446R unknown Het
Rc3h2 C A 2: 37,409,605 V138L possibly damaging Het
Rorc G A 3: 94,377,608 probably null Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sart3 A G 5: 113,762,835 Y181H probably damaging Het
Sbpl A T 17: 23,953,465 M160K possibly damaging Het
Sh3gl3 A G 7: 82,284,142 S238G probably benign Het
Slc22a30 A G 19: 8,336,717 probably null Het
Slc3a1 A T 17: 85,064,014 R665* probably null Het
Stk32a C A 18: 43,297,584 Y186* probably null Het
Stxbp6 T C 12: 44,902,880 N89D probably benign Het
Svep1 A G 4: 58,070,262 F2508S possibly damaging Het
Tas1r1 A G 4: 152,032,238 V313A possibly damaging Het
Tmem81 T C 1: 132,507,617 Y54H probably damaging Het
Tmtc1 T C 6: 148,271,487 N582S probably damaging Het
Top2b T C 14: 16,416,653 S1138P probably benign Het
Trim24 T A 6: 37,965,521 N989K possibly damaging Het
Trim72 T A 7: 128,007,649 M145K probably benign Het
Ttll9 T A 2: 152,989,603 S154T probably damaging Het
Tusc3 T C 8: 39,126,587 V286A probably benign Het
Vat1l C A 8: 114,236,778 H185N probably damaging Het
Vmn1r209 A T 13: 22,805,958 D187E probably damaging Het
Vmn2r87 T C 10: 130,477,547 N450S probably benign Het
Wdr7 T A 18: 63,724,139 D95E possibly damaging Het
Zfp937 C T 2: 150,239,519 H490Y probably benign Het
Zfp974 A T 7: 27,911,519 H260Q possibly damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTGACTCTGGATGAAGCTG -3'
(R):5'- ACACTAGGGATTGATGGCAGTG -3'

Sequencing Primer
(F):5'- CTGAGTGATACAGAGTGCTTACC -3'
(R):5'- ATGGCCACCTCTGAGTCTGATG -3'
Posted On2019-06-26