Incidental Mutation 'R7162:Cables1'
ID557688
Institutional Source Beutler Lab
Gene Symbol Cables1
Ensembl Gene ENSMUSG00000040957
Gene NameCDK5 and Abl enzyme substrate 1
Synonymsik3-1, interactor-1 with cdk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R7162 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location11839220-11945630 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 11926366 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]
Predicted Effect probably null
Transcript: ENSMUST00000046948
SMART Domains Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 456 544 1.83e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171109
SMART Domains Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 482 570 1.83e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 C T 1: 87,127,749 T506I unknown Het
Ank1 T C 8: 23,132,354 W1640R possibly damaging Het
Atp2a2 A G 5: 122,489,324 M126T probably benign Het
Bptf A T 11: 107,043,631 probably null Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Cacna1b A C 2: 24,700,022 I558S probably benign Het
Ccdc166 A G 15: 75,981,195 S308P probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfhr2 A G 1: 139,813,526 V237A probably benign Het
Clybl C A 14: 122,371,320 S108* probably null Het
Cubn A G 2: 13,342,498 Y2070H probably damaging Het
Cyp8b1 A G 9: 121,915,711 F185S probably damaging Het
Dennd2c T A 3: 103,156,107 V620D probably damaging Het
Dis3l2 T C 1: 87,044,030 F597L possibly damaging Het
Eif3f G A 7: 108,940,731 R282H probably benign Het
Ell C A 8: 70,578,909 R86S possibly damaging Het
Eppk1 A G 15: 76,106,609 V2024A possibly damaging Het
Exoc6 T C 19: 37,577,118 I214T probably damaging Het
Faim2 A G 15: 99,521,167 probably null Het
Gli1 A G 10: 127,332,437 S516P probably benign Het
Gm18596 A T 10: 77,742,200 S147T unknown Het
Gm19965 A G 1: 116,822,365 Y592C unknown Het
Gng12 T C 6: 67,017,301 S36P unknown Het
Gramd3 G A 18: 56,485,457 probably null Het
Hmcn1 T A 1: 150,748,993 T1054S probably benign Het
Ifngr1 A G 10: 19,609,353 T367A probably benign Het
Il21r G T 7: 125,632,311 V304L probably benign Het
Ino80d G A 1: 63,065,735 T394M probably damaging Het
Itfg2 C T 6: 128,410,583 V380M probably damaging Het
Kcna5 C T 6: 126,533,843 V441I possibly damaging Het
Kcp T A 6: 29,497,200 probably null Het
Kdf1 C T 4: 133,529,918 T375I unknown Het
Klk1b1 A T 7: 43,969,247 D16V probably damaging Het
Krtap5-4 A C 7: 142,303,598 T2P unknown Het
Lamtor1 A G 7: 101,906,036 D13G probably benign Het
Lrp10 T C 14: 54,465,706 V72A possibly damaging Het
Lrrc1 C A 9: 77,432,190 A503S probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Myo5b C G 18: 74,695,427 L717V probably benign Het
Myoz3 T A 18: 60,576,413 R225S probably damaging Het
Myrf A G 19: 10,218,646 F335L possibly damaging Het
Nfib A C 4: 82,350,440 S292A probably damaging Het
Notch3 G T 17: 32,146,449 H1096Q probably damaging Het
Nt5c1a A G 4: 123,214,105 R194G probably benign Het
Olfr76 A G 19: 12,120,137 F192L possibly damaging Het
Olfr958 A G 9: 39,550,229 I214T probably damaging Het
Parp4 A G 14: 56,648,876 E1804G unknown Het
Pcdhac2 A T 18: 37,145,787 I607L probably benign Het
Pcdhb5 A G 18: 37,321,686 D373G probably benign Het
Pcf11 A T 7: 92,664,013 V154E probably damaging Het
Pdia3 T G 2: 121,429,521 D180E probably benign Het
Piezo2 C A 18: 63,124,709 V313F possibly damaging Het
Pik3ap1 C A 19: 41,321,526 A452S probably benign Het
Plb1 A G 5: 32,349,663 K1194R probably benign Het
Pld3 A C 7: 27,532,474 W431G probably damaging Het
Plekha3 T C 2: 76,692,766 probably null Het
Ppm1f G T 16: 16,914,193 R169L probably damaging Het
Ppp2r3d A G 9: 124,439,673 V60A Het
Prop1 T A 11: 50,952,054 D102V probably damaging Het
Rbm27 G A 18: 42,314,027 G446R unknown Het
Rc3h2 C A 2: 37,409,605 V138L possibly damaging Het
Rorc G A 3: 94,377,608 probably null Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sart3 A G 5: 113,762,835 Y181H probably damaging Het
Sbpl A T 17: 23,953,465 M160K possibly damaging Het
Sh3gl3 A G 7: 82,284,142 S238G probably benign Het
Slc22a30 A G 19: 8,336,717 probably null Het
Slc3a1 A T 17: 85,064,014 R665* probably null Het
Stk32a C A 18: 43,297,584 Y186* probably null Het
Stxbp6 T C 12: 44,902,880 N89D probably benign Het
Svep1 A G 4: 58,070,262 F2508S possibly damaging Het
Tas1r1 A G 4: 152,032,238 V313A possibly damaging Het
Tmem81 T C 1: 132,507,617 Y54H probably damaging Het
Tmtc1 T C 6: 148,271,487 N582S probably damaging Het
Top2b T C 14: 16,416,653 S1138P probably benign Het
Trim24 T A 6: 37,965,521 N989K possibly damaging Het
Trim72 T A 7: 128,007,649 M145K probably benign Het
Ttll9 T A 2: 152,989,603 S154T probably damaging Het
Tusc3 T C 8: 39,126,587 V286A probably benign Het
Vat1l C A 8: 114,236,778 H185N probably damaging Het
Vmn1r209 A T 13: 22,805,958 D187E probably damaging Het
Vmn2r87 T C 10: 130,477,547 N450S probably benign Het
Wdr7 T A 18: 63,724,139 D95E possibly damaging Het
Zfp937 C T 2: 150,239,519 H490Y probably benign Het
Zfp974 A T 7: 27,911,519 H260Q possibly damaging Het
Other mutations in Cables1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Cables1 APN 18 11944564 missense probably damaging 0.99
IGL01373:Cables1 APN 18 11888764 missense probably damaging 0.98
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R2886:Cables1 UTSW 18 11939732 missense possibly damaging 0.80
R4691:Cables1 UTSW 18 11840523 nonsense probably null
R4845:Cables1 UTSW 18 11944488 missense probably damaging 0.99
R4964:Cables1 UTSW 18 11941277 missense possibly damaging 0.92
R5286:Cables1 UTSW 18 11924827 missense probably benign 0.11
R5756:Cables1 UTSW 18 11941353 missense probably damaging 1.00
R6755:Cables1 UTSW 18 11939825 missense probably null 1.00
R7242:Cables1 UTSW 18 11840007 missense possibly damaging 0.93
R7410:Cables1 UTSW 18 11941225 missense probably benign
R7411:Cables1 UTSW 18 11840515 missense probably benign 0.01
R7965:Cables1 UTSW 18 11840212 missense probably benign 0.06
Z1177:Cables1 UTSW 18 11941317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGATGTCTCGGCATTCTC -3'
(R):5'- TGTACATGCTCAGGAGTGAAGG -3'

Sequencing Primer
(F):5'- ATTCTCCGAGCAGCCTCAG -3'
(R):5'- CGAAAACTGAGCTGGTAGTTTTTATG -3'
Posted On2019-06-26