Incidental Mutation 'R7163:Pla2g4a'
ID557706
Institutional Source Beutler Lab
Gene Symbol Pla2g4a
Ensembl Gene ENSMUSG00000056220
Gene Namephospholipase A2, group IVA (cytosolic, calcium-dependent)
SynonymsType IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R7163 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location149829618-149961290 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 149840665 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 690 (K690*)
Ref Sequence ENSEMBL: ENSMUSP00000070868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926]
Predicted Effect probably null
Transcript: ENSMUST00000070200
AA Change: K690*
SMART Domains Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: K690*

DomainStartEndE-ValueType
C2 19 121 8.23e-17 SMART
PLAc 117 668 N/A SMART
Blast:PLAc 706 748 3e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111926
AA Change: K682*
SMART Domains Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: K682*

DomainStartEndE-ValueType
C2 11 113 8.23e-17 SMART
PLAc 109 660 N/A SMART
Blast:PLAc 698 740 3e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,408,072 K4R possibly damaging Het
A830018L16Rik G A 1: 11,414,624 G19D probably damaging Het
Abca3 A T 17: 24,364,942 M102L probably benign Het
Adam19 A T 11: 46,131,717 Y499F probably benign Het
Adck2 T C 6: 39,583,863 V444A probably damaging Het
Adck5 T C 15: 76,593,816 V214A probably damaging Het
Agrn G A 4: 156,178,509 T437M probably damaging Het
Aox3 A T 1: 58,119,512 I81F probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Blmh A G 11: 76,946,161 Y23C unknown Het
Cacnb1 A G 11: 98,012,900 V109A probably benign Het
Ccdc27 C T 4: 154,032,825 R555H not run Het
Cep170 A C 1: 176,774,465 S358R probably damaging Het
Cfap46 A T 7: 139,618,078 probably null Het
Dclk1 G T 3: 55,256,128 E214* probably null Het
Dhrs1 A G 14: 55,739,381 L282P probably benign Het
Dlgap5 A G 14: 47,399,638 L461P probably damaging Het
Elp2 G T 18: 24,614,446 C185F probably benign Het
Fbxw7 T C 3: 84,925,585 probably benign Het
Fga T C 3: 83,026,264 V17A probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm43302 T A 5: 105,293,627 probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hcn1 A T 13: 117,925,547 I450L unknown Het
Hydin T A 8: 110,603,336 C4901S probably benign Het
Ino80 A T 2: 119,392,875 I1186N probably damaging Het
Ints7 T A 1: 191,617,837 I781N possibly damaging Het
Irf2 T A 8: 46,837,677 V178E possibly damaging Het
Iws1 T A 18: 32,093,224 S722T possibly damaging Het
Jak1 G A 4: 101,175,188 S407F probably damaging Het
Kdm3a G T 6: 71,632,077 D55E probably damaging Het
Kdm5d T C Y: 899,940 S169P probably damaging Het
Kif15 A G 9: 123,017,657 N1348S probably damaging Het
Kpna7 G A 5: 145,002,396 P187L unknown Het
Krt35 A T 11: 100,096,158 F10Y probably damaging Het
Lemd1 G T 1: 132,256,737 V131F probably benign Het
Mcf2l G A 8: 12,915,439 R4H probably benign Het
Megf6 C T 4: 154,267,441 R1166C probably damaging Het
Mmp11 T C 10: 75,926,576 I308V possibly damaging Het
Mrgpra4 A G 7: 47,981,490 V121A probably benign Het
Myl2 T A 5: 122,101,822 I26N probably damaging Het
Myo15 A G 11: 60,498,369 M862V Het
Nckap5l T C 15: 99,433,473 H64R probably damaging Het
Nipsnap2 A C 5: 129,744,710 E90A probably benign Het
Nup210 G T 6: 91,073,331 N385K probably damaging Het
Olfr1029 T A 2: 85,975,588 L115Q probably damaging Het
Olfr311 T C 11: 58,841,186 V24A probably benign Het
Olfr330 C A 11: 58,529,168 E273* probably null Het
Olfr897-ps1 T C 9: 38,309,049 F85L probably damaging Het
Olfr90 T C 17: 37,086,045 N40S probably damaging Het
Park2 G A 17: 12,061,547 C430Y probably damaging Het
Pcmt1 A T 10: 7,638,158 M249K probably benign Het
Pde3a T C 6: 141,487,544 L767P probably damaging Het
Pde8a T C 7: 81,306,708 V285A possibly damaging Het
Plxna4 T C 6: 32,496,756 H442R probably benign Het
Polr1b A G 2: 129,126,011 D1108G probably benign Het
Sec23ip T C 7: 128,762,533 probably null Het
Slc24a3 A G 2: 145,244,991 D57G probably benign Het
Sprtn T G 8: 124,898,305 F50V probably damaging Het
Srr A G 11: 74,913,002 F43S probably damaging Het
Szt2 A G 4: 118,405,530 F17L possibly damaging Het
Taar1 G T 10: 23,921,020 M205I probably benign Het
Tas2r143 A G 6: 42,400,268 I11V probably benign Het
Tlx1 T C 19: 45,151,216 S101P probably damaging Het
Tmeff2 T C 1: 50,938,344 probably null Het
Vhl A G 6: 113,629,490 D156G possibly damaging Het
Washc4 T A 10: 83,591,033 D1068E probably damaging Het
Zfp513 A G 5: 31,200,732 V101A probably benign Het
Zfp82 T C 7: 30,062,244 R71G probably benign Het
Other mutations in Pla2g4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Pla2g4a APN 1 149886203 missense probably benign 0.08
IGL00763:Pla2g4a APN 1 149851325 missense probably damaging 1.00
IGL01548:Pla2g4a APN 1 149932656 critical splice donor site probably null
IGL01683:Pla2g4a APN 1 149857654 missense probably benign 0.05
IGL01903:Pla2g4a APN 1 149840619 missense possibly damaging 0.51
IGL02049:Pla2g4a APN 1 149861096 missense probably benign 0.12
IGL02103:Pla2g4a APN 1 149901199 missense probably damaging 0.99
IGL03132:Pla2g4a APN 1 149902284 splice site probably benign
IGL03299:Pla2g4a APN 1 149851367 missense probably damaging 1.00
IGL03302:Pla2g4a APN 1 149864947 missense probably benign 0.00
R0110:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0469:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0488:Pla2g4a UTSW 1 149871445 missense probably damaging 1.00
R0606:Pla2g4a UTSW 1 149840704 missense probably benign 0.44
R1468:Pla2g4a UTSW 1 149887593 splice site probably benign
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1521:Pla2g4a UTSW 1 149857686 critical splice acceptor site probably null
R1718:Pla2g4a UTSW 1 149871523 splice site probably benign
R1778:Pla2g4a UTSW 1 149902445 splice site probably benign
R1967:Pla2g4a UTSW 1 149922081 missense probably damaging 1.00
R2063:Pla2g4a UTSW 1 149840676 missense possibly damaging 0.94
R2291:Pla2g4a UTSW 1 149901189 missense probably damaging 1.00
R3855:Pla2g4a UTSW 1 149830177 missense possibly damaging 0.86
R4512:Pla2g4a UTSW 1 149861051 splice site probably null
R4568:Pla2g4a UTSW 1 149842226 missense probably benign 0.43
R5266:Pla2g4a UTSW 1 149865167 missense possibly damaging 0.79
R5855:Pla2g4a UTSW 1 149880063 missense probably damaging 0.99
R5897:Pla2g4a UTSW 1 149865148 missense probably damaging 0.99
R6012:Pla2g4a UTSW 1 149932677 missense possibly damaging 0.55
R6193:Pla2g4a UTSW 1 149902430 missense probably damaging 1.00
R6246:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6248:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6258:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6260:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6293:Pla2g4a UTSW 1 149880047 missense probably damaging 0.98
R6310:Pla2g4a UTSW 1 149842226 missense possibly damaging 0.88
R6490:Pla2g4a UTSW 1 149851335 nonsense probably null
R6502:Pla2g4a UTSW 1 149872616 nonsense probably null
R6614:Pla2g4a UTSW 1 149842235 missense probably benign 0.07
R6671:Pla2g4a UTSW 1 149887631 missense probably benign
R6745:Pla2g4a UTSW 1 149886230 missense probably benign 0.07
R6880:Pla2g4a UTSW 1 149851451 missense possibly damaging 0.90
R7058:Pla2g4a UTSW 1 149851352 missense probably damaging 1.00
R7422:Pla2g4a UTSW 1 149932687 missense probably benign 0.32
R7454:Pla2g4a UTSW 1 149872690 missense possibly damaging 0.63
R7474:Pla2g4a UTSW 1 149865200 missense possibly damaging 0.88
R7514:Pla2g4a UTSW 1 149851362 missense probably damaging 1.00
R7536:Pla2g4a UTSW 1 149880017 missense probably damaging 1.00
R7682:Pla2g4a UTSW 1 149886271 missense probably damaging 1.00
R7744:Pla2g4a UTSW 1 149861102 missense probably benign 0.06
R7766:Pla2g4a UTSW 1 149861058 missense probably benign 0.00
R7783:Pla2g4a UTSW 1 149872744 missense probably damaging 1.00
R8031:Pla2g4a UTSW 1 149901213 missense possibly damaging 0.87
R8145:Pla2g4a UTSW 1 149840643 missense probably benign 0.42
R8189:Pla2g4a UTSW 1 149857586 missense probably benign 0.04
R8252:Pla2g4a UTSW 1 149851307 missense probably damaging 1.00
R8315:Pla2g4a UTSW 1 149886214 missense probably benign 0.02
X0021:Pla2g4a UTSW 1 149864926 missense possibly damaging 0.66
Z1177:Pla2g4a UTSW 1 149871434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACATCATTCAGGAAAATAAGGC -3'
(R):5'- CCAACTTGAGTGTGGCTGAC -3'

Sequencing Primer
(F):5'- AAGGCACCATGTTTTGCATATGGTC -3'
(R):5'- AACTTGAGTGTGGCTGACTAGGG -3'
Posted On2019-06-26