Incidental Mutation 'R7163:Slc24a3'
ID557712
Institutional Source Beutler Lab
Gene Symbol Slc24a3
Ensembl Gene ENSMUSG00000063873
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 3
SynonymsNCKX3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7163 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location145167754-145642166 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145244991 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 57 (D57G)
Ref Sequence ENSEMBL: ENSMUSP00000105634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081121] [ENSMUST00000110007]
Predicted Effect probably benign
Transcript: ENSMUST00000081121
AA Change: D7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079897
Gene: ENSMUSG00000063873
AA Change: D7G

DomainStartEndE-ValueType
Pfam:Na_Ca_ex 72 204 8.6e-33 PFAM
coiled coil region 353 382 N/A INTRINSIC
Pfam:Na_Ca_ex 437 577 2.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110007
AA Change: D57G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105634
Gene: ENSMUSG00000063873
AA Change: D57G

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Na_Ca_ex 112 255 2.6e-32 PFAM
coiled coil region 403 432 N/A INTRINSIC
Pfam:Na_Ca_ex 477 629 6.1e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plasma membrane sodium/calcium exchangers are an important component of intracellular calcium homeostasis and electrical conduction. Potassium-dependent sodium/calcium exchangers such as SLC24A3 are believed to transport 1 intracellular calcium and 1 potassium ion in exchange for 4 extracellular sodium ions (Kraev et al., 2001 [PubMed 11294880]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,408,072 K4R possibly damaging Het
A830018L16Rik G A 1: 11,414,624 G19D probably damaging Het
Abca3 A T 17: 24,364,942 M102L probably benign Het
Adam19 A T 11: 46,131,717 Y499F probably benign Het
Adck2 T C 6: 39,583,863 V444A probably damaging Het
Adck5 T C 15: 76,593,816 V214A probably damaging Het
Agrn G A 4: 156,178,509 T437M probably damaging Het
Aox3 A T 1: 58,119,512 I81F probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Blmh A G 11: 76,946,161 Y23C unknown Het
Cacnb1 A G 11: 98,012,900 V109A probably benign Het
Ccdc27 C T 4: 154,032,825 R555H not run Het
Cep170 A C 1: 176,774,465 S358R probably damaging Het
Cfap46 A T 7: 139,618,078 probably null Het
Dclk1 G T 3: 55,256,128 E214* probably null Het
Dhrs1 A G 14: 55,739,381 L282P probably benign Het
Dlgap5 A G 14: 47,399,638 L461P probably damaging Het
Elp2 G T 18: 24,614,446 C185F probably benign Het
Fbxw7 T C 3: 84,925,585 probably benign Het
Fga T C 3: 83,026,264 V17A probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm43302 T A 5: 105,293,627 probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hcn1 A T 13: 117,925,547 I450L unknown Het
Hydin T A 8: 110,603,336 C4901S probably benign Het
Ino80 A T 2: 119,392,875 I1186N probably damaging Het
Ints7 T A 1: 191,617,837 I781N possibly damaging Het
Irf2 T A 8: 46,837,677 V178E possibly damaging Het
Iws1 T A 18: 32,093,224 S722T possibly damaging Het
Jak1 G A 4: 101,175,188 S407F probably damaging Het
Kdm3a G T 6: 71,632,077 D55E probably damaging Het
Kdm5d T C Y: 899,940 S169P probably damaging Het
Kif15 A G 9: 123,017,657 N1348S probably damaging Het
Kpna7 G A 5: 145,002,396 P187L unknown Het
Krt35 A T 11: 100,096,158 F10Y probably damaging Het
Lemd1 G T 1: 132,256,737 V131F probably benign Het
Mcf2l G A 8: 12,915,439 R4H probably benign Het
Megf6 C T 4: 154,267,441 R1166C probably damaging Het
Mmp11 T C 10: 75,926,576 I308V possibly damaging Het
Mrgpra4 A G 7: 47,981,490 V121A probably benign Het
Myl2 T A 5: 122,101,822 I26N probably damaging Het
Myo15 A G 11: 60,498,369 M862V Het
Nckap5l T C 15: 99,433,473 H64R probably damaging Het
Nipsnap2 A C 5: 129,744,710 E90A probably benign Het
Nup210 G T 6: 91,073,331 N385K probably damaging Het
Olfr1029 T A 2: 85,975,588 L115Q probably damaging Het
Olfr311 T C 11: 58,841,186 V24A probably benign Het
Olfr330 C A 11: 58,529,168 E273* probably null Het
Olfr897-ps1 T C 9: 38,309,049 F85L probably damaging Het
Olfr90 T C 17: 37,086,045 N40S probably damaging Het
Park2 G A 17: 12,061,547 C430Y probably damaging Het
Pcmt1 A T 10: 7,638,158 M249K probably benign Het
Pde3a T C 6: 141,487,544 L767P probably damaging Het
Pde8a T C 7: 81,306,708 V285A possibly damaging Het
Pla2g4a T A 1: 149,840,665 K690* probably null Het
Plxna4 T C 6: 32,496,756 H442R probably benign Het
Polr1b A G 2: 129,126,011 D1108G probably benign Het
Sec23ip T C 7: 128,762,533 probably null Het
Sprtn T G 8: 124,898,305 F50V probably damaging Het
Srr A G 11: 74,913,002 F43S probably damaging Het
Szt2 A G 4: 118,405,530 F17L possibly damaging Het
Taar1 G T 10: 23,921,020 M205I probably benign Het
Tas2r143 A G 6: 42,400,268 I11V probably benign Het
Tlx1 T C 19: 45,151,216 S101P probably damaging Het
Tmeff2 T C 1: 50,938,344 probably null Het
Vhl A G 6: 113,629,490 D156G possibly damaging Het
Washc4 T A 10: 83,591,033 D1068E probably damaging Het
Zfp513 A G 5: 31,200,732 V101A probably benign Het
Zfp82 T C 7: 30,062,244 R71G probably benign Het
Other mutations in Slc24a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Slc24a3 APN 2 145616714 critical splice donor site probably null
IGL01327:Slc24a3 APN 2 145602558 missense probably benign
IGL01413:Slc24a3 APN 2 145640249 missense probably damaging 1.00
IGL01418:Slc24a3 APN 2 145640249 missense probably damaging 1.00
IGL01468:Slc24a3 APN 2 145613580 missense probably benign 0.16
IGL01629:Slc24a3 APN 2 145640210 splice site probably benign
IGL01973:Slc24a3 APN 2 145245027 missense probably benign 0.01
IGL02021:Slc24a3 APN 2 145518916 missense probably damaging 1.00
IGL02378:Slc24a3 APN 2 145518402 missense possibly damaging 0.78
R0242:Slc24a3 UTSW 2 145606664 missense probably benign 0.02
R0242:Slc24a3 UTSW 2 145606664 missense probably benign 0.02
R0685:Slc24a3 UTSW 2 145606795 missense probably benign 0.00
R0827:Slc24a3 UTSW 2 145518492 splice site probably benign
R1669:Slc24a3 UTSW 2 145613592 missense probably damaging 1.00
R2698:Slc24a3 UTSW 2 145613567 missense probably benign 0.01
R3796:Slc24a3 UTSW 2 145616681 missense probably damaging 1.00
R4073:Slc24a3 UTSW 2 145613716 intron probably benign
R4386:Slc24a3 UTSW 2 145606826 missense probably benign 0.00
R5125:Slc24a3 UTSW 2 145518847 missense possibly damaging 0.95
R5169:Slc24a3 UTSW 2 145640264 missense probably benign 0.18
R5248:Slc24a3 UTSW 2 145604517 missense probably benign 0.40
R5394:Slc24a3 UTSW 2 145613574 missense probably benign 0.42
R5549:Slc24a3 UTSW 2 145606864 missense probably damaging 1.00
R6476:Slc24a3 UTSW 2 145606830 missense probably benign
R6777:Slc24a3 UTSW 2 145640282 missense probably damaging 1.00
R6814:Slc24a3 UTSW 2 145616710 nonsense probably null
R7446:Slc24a3 UTSW 2 145580982 missense probably damaging 1.00
R7525:Slc24a3 UTSW 2 145613530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTCAGAGAGCTAGATTCAAG -3'
(R):5'- TGAGACAGGTCTTTAGATGCAG -3'

Sequencing Primer
(F):5'- TCAGAGAGCTAGATTCAAGACATC -3'
(R):5'- AGAAGAGATATGTCATCCAGCTC -3'
Posted On2019-06-26