Incidental Mutation 'R7163:Fga'
ID557714
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R7163 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83026264 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000029630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
AA Change: V17A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: V17A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166581
AA Change: V17A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: V17A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,408,072 K4R possibly damaging Het
A830018L16Rik G A 1: 11,414,624 G19D probably damaging Het
Abca3 A T 17: 24,364,942 M102L probably benign Het
Adam19 A T 11: 46,131,717 Y499F probably benign Het
Adck2 T C 6: 39,583,863 V444A probably damaging Het
Adck5 T C 15: 76,593,816 V214A probably damaging Het
Agrn G A 4: 156,178,509 T437M probably damaging Het
Aox3 A T 1: 58,119,512 I81F probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Blmh A G 11: 76,946,161 Y23C unknown Het
Cacnb1 A G 11: 98,012,900 V109A probably benign Het
Ccdc27 C T 4: 154,032,825 R555H not run Het
Cep170 A C 1: 176,774,465 S358R probably damaging Het
Cfap46 A T 7: 139,618,078 probably null Het
Dclk1 G T 3: 55,256,128 E214* probably null Het
Dhrs1 A G 14: 55,739,381 L282P probably benign Het
Dlgap5 A G 14: 47,399,638 L461P probably damaging Het
Elp2 G T 18: 24,614,446 C185F probably benign Het
Fbxw7 T C 3: 84,925,585 probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm43302 T A 5: 105,293,627 probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hcn1 A T 13: 117,925,547 I450L unknown Het
Hydin T A 8: 110,603,336 C4901S probably benign Het
Ino80 A T 2: 119,392,875 I1186N probably damaging Het
Ints7 T A 1: 191,617,837 I781N possibly damaging Het
Irf2 T A 8: 46,837,677 V178E possibly damaging Het
Iws1 T A 18: 32,093,224 S722T possibly damaging Het
Jak1 G A 4: 101,175,188 S407F probably damaging Het
Kdm3a G T 6: 71,632,077 D55E probably damaging Het
Kdm5d T C Y: 899,940 S169P probably damaging Het
Kif15 A G 9: 123,017,657 N1348S probably damaging Het
Kpna7 G A 5: 145,002,396 P187L unknown Het
Krt35 A T 11: 100,096,158 F10Y probably damaging Het
Lemd1 G T 1: 132,256,737 V131F probably benign Het
Mcf2l G A 8: 12,915,439 R4H probably benign Het
Megf6 C T 4: 154,267,441 R1166C probably damaging Het
Mmp11 T C 10: 75,926,576 I308V possibly damaging Het
Mrgpra4 A G 7: 47,981,490 V121A probably benign Het
Myl2 T A 5: 122,101,822 I26N probably damaging Het
Myo15 A G 11: 60,498,369 M862V Het
Nckap5l T C 15: 99,433,473 H64R probably damaging Het
Nipsnap2 A C 5: 129,744,710 E90A probably benign Het
Nup210 G T 6: 91,073,331 N385K probably damaging Het
Olfr1029 T A 2: 85,975,588 L115Q probably damaging Het
Olfr311 T C 11: 58,841,186 V24A probably benign Het
Olfr330 C A 11: 58,529,168 E273* probably null Het
Olfr897-ps1 T C 9: 38,309,049 F85L probably damaging Het
Olfr90 T C 17: 37,086,045 N40S probably damaging Het
Park2 G A 17: 12,061,547 C430Y probably damaging Het
Pcmt1 A T 10: 7,638,158 M249K probably benign Het
Pde3a T C 6: 141,487,544 L767P probably damaging Het
Pde8a T C 7: 81,306,708 V285A possibly damaging Het
Pla2g4a T A 1: 149,840,665 K690* probably null Het
Plxna4 T C 6: 32,496,756 H442R probably benign Het
Polr1b A G 2: 129,126,011 D1108G probably benign Het
Sec23ip T C 7: 128,762,533 probably null Het
Slc24a3 A G 2: 145,244,991 D57G probably benign Het
Sprtn T G 8: 124,898,305 F50V probably damaging Het
Srr A G 11: 74,913,002 F43S probably damaging Het
Szt2 A G 4: 118,405,530 F17L possibly damaging Het
Taar1 G T 10: 23,921,020 M205I probably benign Het
Tas2r143 A G 6: 42,400,268 I11V probably benign Het
Tlx1 T C 19: 45,151,216 S101P probably damaging Het
Tmeff2 T C 1: 50,938,344 probably null Het
Vhl A G 6: 113,629,490 D156G possibly damaging Het
Washc4 T A 10: 83,591,033 D1068E probably damaging Het
Zfp513 A G 5: 31,200,732 V101A probably benign Het
Zfp82 T C 7: 30,062,244 R71G probably benign Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATTATGGTCAGAGCACAGGAC -3'
(R):5'- AGATCTCTCGTTATCCTAGGGC -3'

Sequencing Primer
(F):5'- CAGGACACACTGTGAGCTTTG -3'
(R):5'- GGCCTCCCTCTGGACATCAC -3'
Posted On2019-06-26