Incidental Mutation 'R7163:Szt2'
ID 557717
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 045330-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R7163 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118262727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 17 (F17L)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019229] [ENSMUST00000073881] [ENSMUST00000075406] [ENSMUST00000084319] [ENSMUST00000106384] [ENSMUST00000126089] [ENSMUST00000144577]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019229
SMART Domains Protein: ENSMUSP00000019229
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 1 265 1.2e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073881
SMART Domains Protein: ENSMUSP00000073544
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 129 1.4e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075406
AA Change: F17L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: F17L

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084319
SMART Domains Protein: ENSMUSP00000081346
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 179 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106384
SMART Domains Protein: ENSMUSP00000101992
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 1 234 3.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126089
Predicted Effect probably benign
Transcript: ENSMUST00000144577
SMART Domains Protein: ENSMUSP00000120158
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 75 3.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,319,372 (GRCm39) K4R possibly damaging Het
A830018L16Rik G A 1: 11,484,848 (GRCm39) G19D probably damaging Het
Abca3 A T 17: 24,583,916 (GRCm39) M102L probably benign Het
Adam19 A T 11: 46,022,544 (GRCm39) Y499F probably benign Het
Adck2 T C 6: 39,560,797 (GRCm39) V444A probably damaging Het
Adck5 T C 15: 76,478,016 (GRCm39) V214A probably damaging Het
Agrn G A 4: 156,262,966 (GRCm39) T437M probably damaging Het
Aox3 A T 1: 58,158,671 (GRCm39) I81F probably damaging Het
Bcl6 G A 16: 23,784,976 (GRCm39) R675* probably null Het
Blmh A G 11: 76,836,987 (GRCm39) Y23C unknown Het
Cacnb1 A G 11: 97,903,726 (GRCm39) V109A probably benign Het
Ccdc27 C T 4: 154,117,282 (GRCm39) R555H not run Het
Cep170 A C 1: 176,602,031 (GRCm39) S358R probably damaging Het
Cfap46 A T 7: 139,197,994 (GRCm39) probably null Het
Dclk1 G T 3: 55,163,549 (GRCm39) E214* probably null Het
Dhrs1 A G 14: 55,976,838 (GRCm39) L282P probably benign Het
Dlgap5 A G 14: 47,637,095 (GRCm39) L461P probably damaging Het
Elp2 G T 18: 24,747,503 (GRCm39) C185F probably benign Het
Fbxw7 T C 3: 84,832,892 (GRCm39) probably benign Het
Fga T C 3: 82,933,571 (GRCm39) V17A probably benign Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gm43302 T A 5: 105,441,493 (GRCm39) probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,371,014 (GRCm39) probably benign Het
Hcn1 A T 13: 118,062,083 (GRCm39) I450L unknown Het
Hydin T A 8: 111,329,968 (GRCm39) C4901S probably benign Het
Ino80 A T 2: 119,223,356 (GRCm39) I1186N probably damaging Het
Ints7 T A 1: 191,349,949 (GRCm39) I781N possibly damaging Het
Irf2 T A 8: 47,290,712 (GRCm39) V178E possibly damaging Het
Iws1 T A 18: 32,226,277 (GRCm39) S722T possibly damaging Het
Jak1 G A 4: 101,032,385 (GRCm39) S407F probably damaging Het
Kdm3a G T 6: 71,609,061 (GRCm39) D55E probably damaging Het
Kdm5d T C Y: 899,940 (GRCm39) S169P probably damaging Het
Kif15 A G 9: 122,846,722 (GRCm39) N1348S probably damaging Het
Kpna7 G A 5: 144,939,206 (GRCm39) P187L unknown Het
Krt35 A T 11: 99,986,984 (GRCm39) F10Y probably damaging Het
Lemd1 G T 1: 132,184,475 (GRCm39) V131F probably benign Het
Mcf2l G A 8: 12,965,439 (GRCm39) R4H probably benign Het
Megf6 C T 4: 154,351,898 (GRCm39) R1166C probably damaging Het
Mmp11 T C 10: 75,762,410 (GRCm39) I308V possibly damaging Het
Mrgpra4 A G 7: 47,631,238 (GRCm39) V121A probably benign Het
Myl2 T A 5: 122,239,885 (GRCm39) I26N probably damaging Het
Myo15a A G 11: 60,389,195 (GRCm39) M862V Het
Nckap5l T C 15: 99,331,354 (GRCm39) H64R probably damaging Het
Nipsnap2 A C 5: 129,821,774 (GRCm39) E90A probably benign Het
Nup210 G T 6: 91,050,313 (GRCm39) N385K probably damaging Het
Or2h2 T C 17: 37,396,937 (GRCm39) N40S probably damaging Het
Or2t48 C A 11: 58,419,994 (GRCm39) E273* probably null Het
Or5m11b T A 2: 85,805,932 (GRCm39) L115Q probably damaging Het
Or8c19-ps1 T C 9: 38,220,345 (GRCm39) F85L probably damaging Het
Or9e1 T C 11: 58,732,012 (GRCm39) V24A probably benign Het
Pcmt1 A T 10: 7,513,922 (GRCm39) M249K probably benign Het
Pde3a T C 6: 141,433,270 (GRCm39) L767P probably damaging Het
Pde8a T C 7: 80,956,456 (GRCm39) V285A possibly damaging Het
Pla2g4a T A 1: 149,716,416 (GRCm39) K690* probably null Het
Plxna4 T C 6: 32,473,691 (GRCm39) H442R probably benign Het
Polr1b A G 2: 128,967,931 (GRCm39) D1108G probably benign Het
Prkn G A 17: 12,280,434 (GRCm39) C430Y probably damaging Het
Sec23ip T C 7: 128,364,257 (GRCm39) probably null Het
Slc24a3 A G 2: 145,086,911 (GRCm39) D57G probably benign Het
Sprtn T G 8: 125,625,044 (GRCm39) F50V probably damaging Het
Srr A G 11: 74,803,828 (GRCm39) F43S probably damaging Het
Taar1 G T 10: 23,796,918 (GRCm39) M205I probably benign Het
Tas2r143 A G 6: 42,377,202 (GRCm39) I11V probably benign Het
Tlx1 T C 19: 45,139,655 (GRCm39) S101P probably damaging Het
Tmeff2 T C 1: 50,977,503 (GRCm39) probably null Het
Vhl A G 6: 113,606,451 (GRCm39) D156G possibly damaging Het
Washc4 T A 10: 83,426,897 (GRCm39) D1068E probably damaging Het
Zfp513 A G 5: 31,358,076 (GRCm39) V101A probably benign Het
Zfp82 T C 7: 29,761,669 (GRCm39) R71G probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGGCAAAACCATTG -3'
(R):5'- AGAAGGTAAGTTAGTTCCCTTCCTC -3'

Sequencing Primer
(F):5'- GCCCCTCCCAGCCTTAACAG -3'
(R):5'- AAGTTAGTTCCCTTCCTCTACATGG -3'
Posted On 2019-06-26