Incidental Mutation 'R7163:Adck5'
ID557761
Institutional Source Beutler Lab
Gene Symbol Adck5
Ensembl Gene ENSMUSG00000022550
Gene NameaarF domain containing kinase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7163 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76576358-76595816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76593816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000125055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably benign
Transcript: ENSMUST00000071898
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160784
AA Change: V214A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550
AA Change: V214A

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 9.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161612
SMART Domains Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161732
SMART Domains Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162503
AA Change: V214A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550
AA Change: V214A

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect probably benign
Transcript: ENSMUST00000230157
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,408,072 K4R possibly damaging Het
A830018L16Rik G A 1: 11,414,624 G19D probably damaging Het
Abca3 A T 17: 24,364,942 M102L probably benign Het
Adam19 A T 11: 46,131,717 Y499F probably benign Het
Adck2 T C 6: 39,583,863 V444A probably damaging Het
Agrn G A 4: 156,178,509 T437M probably damaging Het
Aox3 A T 1: 58,119,512 I81F probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Blmh A G 11: 76,946,161 Y23C unknown Het
Cacnb1 A G 11: 98,012,900 V109A probably benign Het
Ccdc27 C T 4: 154,032,825 R555H not run Het
Cep170 A C 1: 176,774,465 S358R probably damaging Het
Cfap46 A T 7: 139,618,078 probably null Het
Dclk1 G T 3: 55,256,128 E214* probably null Het
Dhrs1 A G 14: 55,739,381 L282P probably benign Het
Dlgap5 A G 14: 47,399,638 L461P probably damaging Het
Elp2 G T 18: 24,614,446 C185F probably benign Het
Fbxw7 T C 3: 84,925,585 probably benign Het
Fga T C 3: 83,026,264 V17A probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm43302 T A 5: 105,293,627 probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hcn1 A T 13: 117,925,547 I450L unknown Het
Hydin T A 8: 110,603,336 C4901S probably benign Het
Ino80 A T 2: 119,392,875 I1186N probably damaging Het
Ints7 T A 1: 191,617,837 I781N possibly damaging Het
Irf2 T A 8: 46,837,677 V178E possibly damaging Het
Iws1 T A 18: 32,093,224 S722T possibly damaging Het
Jak1 G A 4: 101,175,188 S407F probably damaging Het
Kdm3a G T 6: 71,632,077 D55E probably damaging Het
Kdm5d T C Y: 899,940 S169P probably damaging Het
Kif15 A G 9: 123,017,657 N1348S probably damaging Het
Kpna7 G A 5: 145,002,396 P187L unknown Het
Krt35 A T 11: 100,096,158 F10Y probably damaging Het
Lemd1 G T 1: 132,256,737 V131F probably benign Het
Mcf2l G A 8: 12,915,439 R4H probably benign Het
Megf6 C T 4: 154,267,441 R1166C probably damaging Het
Mmp11 T C 10: 75,926,576 I308V possibly damaging Het
Mrgpra4 A G 7: 47,981,490 V121A probably benign Het
Myl2 T A 5: 122,101,822 I26N probably damaging Het
Myo15 A G 11: 60,498,369 M862V Het
Nckap5l T C 15: 99,433,473 H64R probably damaging Het
Nipsnap2 A C 5: 129,744,710 E90A probably benign Het
Nup210 G T 6: 91,073,331 N385K probably damaging Het
Olfr1029 T A 2: 85,975,588 L115Q probably damaging Het
Olfr311 T C 11: 58,841,186 V24A probably benign Het
Olfr330 C A 11: 58,529,168 E273* probably null Het
Olfr897-ps1 T C 9: 38,309,049 F85L probably damaging Het
Olfr90 T C 17: 37,086,045 N40S probably damaging Het
Park2 G A 17: 12,061,547 C430Y probably damaging Het
Pcmt1 A T 10: 7,638,158 M249K probably benign Het
Pde3a T C 6: 141,487,544 L767P probably damaging Het
Pde8a T C 7: 81,306,708 V285A possibly damaging Het
Pla2g4a T A 1: 149,840,665 K690* probably null Het
Plxna4 T C 6: 32,496,756 H442R probably benign Het
Polr1b A G 2: 129,126,011 D1108G probably benign Het
Sec23ip T C 7: 128,762,533 probably null Het
Slc24a3 A G 2: 145,244,991 D57G probably benign Het
Sprtn T G 8: 124,898,305 F50V probably damaging Het
Srr A G 11: 74,913,002 F43S probably damaging Het
Szt2 A G 4: 118,405,530 F17L possibly damaging Het
Taar1 G T 10: 23,921,020 M205I probably benign Het
Tas2r143 A G 6: 42,400,268 I11V probably benign Het
Tlx1 T C 19: 45,151,216 S101P probably damaging Het
Tmeff2 T C 1: 50,938,344 probably null Het
Vhl A G 6: 113,629,490 D156G possibly damaging Het
Washc4 T A 10: 83,591,033 D1068E probably damaging Het
Zfp513 A G 5: 31,200,732 V101A probably benign Het
Zfp82 T C 7: 30,062,244 R71G probably benign Het
Other mutations in Adck5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Adck5 APN 15 76589100 missense possibly damaging 0.59
IGL01366:Adck5 APN 15 76595616 makesense probably null
IGL01534:Adck5 APN 15 76594726 missense probably damaging 1.00
IGL02066:Adck5 APN 15 76595206 missense probably damaging 0.96
IGL02615:Adck5 APN 15 76589167 missense possibly damaging 0.69
IGL02746:Adck5 APN 15 76589154 missense probably benign 0.26
R0865:Adck5 UTSW 15 76595643 missense probably damaging 0.98
R0946:Adck5 UTSW 15 76593286 missense possibly damaging 0.82
R3714:Adck5 UTSW 15 76593938 missense probably damaging 1.00
R3945:Adck5 UTSW 15 76595200 missense probably damaging 1.00
R4373:Adck5 UTSW 15 76594335 unclassified probably benign
R4377:Adck5 UTSW 15 76594335 unclassified probably benign
R5343:Adck5 UTSW 15 76595580 missense probably damaging 0.98
R5372:Adck5 UTSW 15 76594507 unclassified probably benign
R5890:Adck5 UTSW 15 76593585 missense probably damaging 1.00
R6151:Adck5 UTSW 15 76594687 missense possibly damaging 0.81
R6277:Adck5 UTSW 15 76593263 missense possibly damaging 0.58
R6530:Adck5 UTSW 15 76593847 missense probably benign 0.00
R7427:Adck5 UTSW 15 76594385 missense possibly damaging 0.78
R7447:Adck5 UTSW 15 76595196 missense possibly damaging 0.93
R7685:Adck5 UTSW 15 76595388 nonsense probably null
R7745:Adck5 UTSW 15 76594548 missense probably benign 0.36
X0013:Adck5 UTSW 15 76595342 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCTATGTGAAACTGGGCCAAG -3'
(R):5'- TCTGCACGTCTCCGTCAAAG -3'

Sequencing Primer
(F):5'- AAGGGCTGTGCTCCTTCAAC -3'
(R):5'- AAGCGGTCTCGTAGGTCAATGTAC -3'
Posted On2019-06-26