Incidental Mutation 'R7163:Park2'
ID557764
Institutional Source Beutler Lab
Gene Symbol Park2
Ensembl Gene ENSMUSG00000023826
Gene NameParkinson disease (autosomal recessive, juvenile) 2, parkin
SynonymsPRKN
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R7163 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location10840384-12063361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12061547 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 430 (C430Y)
Ref Sequence ENSEMBL: ENSMUSP00000140587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191124]
PDB Structure
NMR structure of ubiquitin-like domain in murine Parkin [SOLUTION NMR]
Crystal structure of ubiquitin-like domain of murine Parkin [X-RAY DIFFRACTION]
Crystal Structure of parkin ubiquitin-like domain R33Q mutant [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000191124
AA Change: C430Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826
AA Change: C430Y

DomainStartEndE-ValueType
UBQ 1 72 3.58e-15 SMART
Blast:UBQ 203 230 2e-6 BLAST
Blast:RING 237 295 7e-11 BLAST
IBR 312 376 1.2e-14 SMART
IBR 400 456 5.16e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,408,072 K4R possibly damaging Het
A830018L16Rik G A 1: 11,414,624 G19D probably damaging Het
Abca3 A T 17: 24,364,942 M102L probably benign Het
Adam19 A T 11: 46,131,717 Y499F probably benign Het
Adck2 T C 6: 39,583,863 V444A probably damaging Het
Adck5 T C 15: 76,593,816 V214A probably damaging Het
Agrn G A 4: 156,178,509 T437M probably damaging Het
Aox3 A T 1: 58,119,512 I81F probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Blmh A G 11: 76,946,161 Y23C unknown Het
Cacnb1 A G 11: 98,012,900 V109A probably benign Het
Ccdc27 C T 4: 154,032,825 R555H not run Het
Cep170 A C 1: 176,774,465 S358R probably damaging Het
Cfap46 A T 7: 139,618,078 probably null Het
Dclk1 G T 3: 55,256,128 E214* probably null Het
Dhrs1 A G 14: 55,739,381 L282P probably benign Het
Dlgap5 A G 14: 47,399,638 L461P probably damaging Het
Elp2 G T 18: 24,614,446 C185F probably benign Het
Fbxw7 T C 3: 84,925,585 probably benign Het
Fga T C 3: 83,026,264 V17A probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm43302 T A 5: 105,293,627 probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hcn1 A T 13: 117,925,547 I450L unknown Het
Hydin T A 8: 110,603,336 C4901S probably benign Het
Ino80 A T 2: 119,392,875 I1186N probably damaging Het
Ints7 T A 1: 191,617,837 I781N possibly damaging Het
Irf2 T A 8: 46,837,677 V178E possibly damaging Het
Iws1 T A 18: 32,093,224 S722T possibly damaging Het
Jak1 G A 4: 101,175,188 S407F probably damaging Het
Kdm3a G T 6: 71,632,077 D55E probably damaging Het
Kdm5d T C Y: 899,940 S169P probably damaging Het
Kif15 A G 9: 123,017,657 N1348S probably damaging Het
Kpna7 G A 5: 145,002,396 P187L unknown Het
Krt35 A T 11: 100,096,158 F10Y probably damaging Het
Lemd1 G T 1: 132,256,737 V131F probably benign Het
Mcf2l G A 8: 12,915,439 R4H probably benign Het
Megf6 C T 4: 154,267,441 R1166C probably damaging Het
Mmp11 T C 10: 75,926,576 I308V possibly damaging Het
Mrgpra4 A G 7: 47,981,490 V121A probably benign Het
Myl2 T A 5: 122,101,822 I26N probably damaging Het
Myo15 A G 11: 60,498,369 M862V Het
Nckap5l T C 15: 99,433,473 H64R probably damaging Het
Nipsnap2 A C 5: 129,744,710 E90A probably benign Het
Nup210 G T 6: 91,073,331 N385K probably damaging Het
Olfr1029 T A 2: 85,975,588 L115Q probably damaging Het
Olfr311 T C 11: 58,841,186 V24A probably benign Het
Olfr330 C A 11: 58,529,168 E273* probably null Het
Olfr897-ps1 T C 9: 38,309,049 F85L probably damaging Het
Olfr90 T C 17: 37,086,045 N40S probably damaging Het
Pcmt1 A T 10: 7,638,158 M249K probably benign Het
Pde3a T C 6: 141,487,544 L767P probably damaging Het
Pde8a T C 7: 81,306,708 V285A possibly damaging Het
Pla2g4a T A 1: 149,840,665 K690* probably null Het
Plxna4 T C 6: 32,496,756 H442R probably benign Het
Polr1b A G 2: 129,126,011 D1108G probably benign Het
Sec23ip T C 7: 128,762,533 probably null Het
Slc24a3 A G 2: 145,244,991 D57G probably benign Het
Sprtn T G 8: 124,898,305 F50V probably damaging Het
Srr A G 11: 74,913,002 F43S probably damaging Het
Szt2 A G 4: 118,405,530 F17L possibly damaging Het
Taar1 G T 10: 23,921,020 M205I probably benign Het
Tas2r143 A G 6: 42,400,268 I11V probably benign Het
Tlx1 T C 19: 45,151,216 S101P probably damaging Het
Tmeff2 T C 1: 50,938,344 probably null Het
Vhl A G 6: 113,629,490 D156G possibly damaging Het
Washc4 T A 10: 83,591,033 D1068E probably damaging Het
Zfp513 A G 5: 31,200,732 V101A probably benign Het
Zfp82 T C 7: 30,062,244 R71G probably benign Het
Other mutations in Park2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4340:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4342:Park2 UTSW 17 11854763 missense probably damaging 1.00
PIT4651001:Park2 UTSW 17 11067243 missense probably damaging 1.00
R0333:Park2 UTSW 17 11067140 missense probably damaging 1.00
R0543:Park2 UTSW 17 11067179 missense probably damaging 1.00
R4460:Park2 UTSW 17 12061646 missense probably damaging 1.00
R4710:Park2 UTSW 17 11854833 missense possibly damaging 0.89
R4742:Park2 UTSW 17 11237704 critical splice donor site probably null
R4752:Park2 UTSW 17 12004123 missense probably benign
R4911:Park2 UTSW 17 10840472 utr 5 prime probably benign
R5653:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5654:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5655:Park2 UTSW 17 11237649 missense probably damaging 1.00
R6360:Park2 UTSW 17 12004052 missense probably damaging 1.00
R6698:Park2 UTSW 17 11067296 splice site probably null
R7241:Park2 UTSW 17 11854861 missense possibly damaging 0.63
R7475:Park2 UTSW 17 11434614 missense probably benign
R7630:Park2 UTSW 17 11237568 missense probably benign
X0010:Park2 UTSW 17 11237576 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCTAGAGCATCCGGACC -3'
(R):5'- GCTTCTGTAATCTGCAGCCTG -3'

Sequencing Primer
(F):5'- TAGAGCATCCGGACCCAGGAG -3'
(R):5'- CGCATTTATGTGCTTATATGCATCG -3'
Posted On2019-06-26