Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Spag16'

557773

Institutional Source

Beutler Lab

Gene Symbol

Spag16

Ensembl Gene

ENSMUSG00000053153

Gene Name

sperm associated antigen 16

Synonyms

4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69826970-70725132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70724866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 615 (H615R)

Ref Sequence

ENSEMBL: ENSMUSP00000069821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053922] [ENSMUST00000065425] [ENSMUST00000161937] [ENSMUST00000162182]

AlphaFold

Q8K450

Predicted Effect

probably benign
Transcript: ENSMUST00000053922

SMART Domains

Protein: ENSMUSP00000058142
Gene: ENSMUSG00000045648

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
VWC	53	109	4.18e0	SMART
VWC	116	171	2.49e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065425
AA Change: H615R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: H615R

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC
WD40	349	388	7.8e-2	SMART
WD40	391	430	6.23e-10	SMART
WD40	433	472	1.34e-9	SMART
WD40	475	514	1.92e-10	SMART
WD40	517	556	2.38e-6	SMART
WD40	559	598	1.42e2	SMART
WD40	600	639	4.83e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161937

SMART Domains

Protein: ENSMUSP00000125014
Gene: ENSMUSG00000045648

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:VWC_def	53	109	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000162182

SMART Domains

Protein: ENSMUSP00000123819
Gene: ENSMUSG00000045648

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:VWC_def	33	62	4e-12	BLAST
VWC	69	124	2.49e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Spag16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Spag16	APN	1	70299650	missense	probably damaging	1.00
IGL01129:Spag16	APN	1	69896522	missense	probably benign	0.01
IGL02117:Spag16	APN	1	69870320	missense	probably damaging	1.00
IGL02245:Spag16	APN	1	69858502	missense	probably benign
IGL02492:Spag16	APN	1	69887529	missense	probably benign
IGL02851:Spag16	APN	1	70264908	missense	possibly damaging	0.76
IGL03271:Spag16	APN	1	69853352	missense	probably benign	0.00
IGL03274:Spag16	APN	1	69844381	splice site	probably benign
PIT4243001:Spag16	UTSW	1	69853381	missense	probably damaging	1.00
R0084:Spag16	UTSW	1	69996839	missense	probably benign	0.02
R0513:Spag16	UTSW	1	70493768	splice site	probably benign
R0653:Spag16	UTSW	1	69870345	missense	probably damaging	1.00
R1165:Spag16	UTSW	1	69996877	missense	probably benign	0.04
R1178:Spag16	UTSW	1	69923658	splice site	probably benign
R1180:Spag16	UTSW	1	69923658	splice site	probably benign
R1404:Spag16	UTSW	1	69895280	splice site	probably benign
R1547:Spag16	UTSW	1	69873243	missense	possibly damaging	0.51
R1689:Spag16	UTSW	1	70461118	missense	probably benign	0.01
R1699:Spag16	UTSW	1	69996856	missense	probably benign	0.05
R1714:Spag16	UTSW	1	69843005	missense	probably damaging	0.97
R1724:Spag16	UTSW	1	70493782	missense	probably damaging	1.00
R1873:Spag16	UTSW	1	69896585	splice site	probably benign
R2196:Spag16	UTSW	1	69858522	missense	possibly damaging	0.92
R2207:Spag16	UTSW	1	70724884	missense	probably benign	0.00
R4058:Spag16	UTSW	1	69853328	missense	probably damaging	0.96
R4276:Spag16	UTSW	1	69873481	intron	probably benign
R4497:Spag16	UTSW	1	70493830	missense	probably damaging	1.00
R4560:Spag16	UTSW	1	69844296	missense	probably benign	0.05
R4648:Spag16	UTSW	1	69827035	missense	probably null	0.99
R4972:Spag16	UTSW	1	70724928	missense	probably damaging	1.00
R5027:Spag16	UTSW	1	69923804	intron	probably benign
R5032:Spag16	UTSW	1	69853352	missense	probably benign	0.00
R5174:Spag16	UTSW	1	70493796	missense	probably damaging	1.00
R5276:Spag16	UTSW	1	69896583	critical splice donor site	probably null
R5537:Spag16	UTSW	1	69827016	missense	probably benign
R5706:Spag16	UTSW	1	69870289	missense	probably benign	0.01
R5834:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R6131:Spag16	UTSW	1	70725083	splice site	probably null
R6246:Spag16	UTSW	1	69923821	missense	probably benign	0.45
R7261:Spag16	UTSW	1	70299621	missense	possibly damaging	0.56
R7298:Spag16	UTSW	1	69919426	splice site	probably null
R7358:Spag16	UTSW	1	69844367	missense	probably benign	0.00
R7431:Spag16	UTSW	1	69923872	missense	unknown
R7508:Spag16	UTSW	1	69887520	missense	possibly damaging	0.93
R7566:Spag16	UTSW	1	69870328	missense	probably damaging	1.00
R7570:Spag16	UTSW	1	69996841	missense	probably benign	0.00
R7598:Spag16	UTSW	1	69870308	missense	probably damaging	1.00
R7942:Spag16	UTSW	1	69827088	missense	probably benign	0.11
R8047:Spag16	UTSW	1	69842996	missense	probably damaging	1.00
R8132:Spag16	UTSW	1	70381302	missense	probably damaging	1.00
R8329:Spag16	UTSW	1	69895248	missense	probably benign	0.00
R8870:Spag16	UTSW	1	69996858	missense	probably benign	0.05
R8930:Spag16	UTSW	1	70299769	critical splice donor site	probably null
R8932:Spag16	UTSW	1	70299769	critical splice donor site	probably null
R8954:Spag16	UTSW	1	69996845	missense
R8998:Spag16	UTSW	1	69896547	missense	probably benign	0.00
R9077:Spag16	UTSW	1	70493771	splice site	probably benign
R9144:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9145:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9148:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9160:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R9192:Spag16	UTSW	1	69923848	missense	unknown
R9436:Spag16	UTSW	1	69853380	missense	probably damaging	0.96
R9582:Spag16	UTSW	1	69858558	missense	probably benign	0.00
R9660:Spag16	UTSW	1	69923683	missense	probably benign	0.03
R9666:Spag16	UTSW	1	70724913	missense	probably damaging	1.00
R9671:Spag16	UTSW	1	69844336	missense	probably benign	0.29
R9728:Spag16	UTSW	1	69923683	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTCTTGAATCACAACCGAAACAGG -3'
(R):5'- GGTCCATATATTATTCACCCAAAGC -3'

Sequencing Primer
(F):5'- CACAACCGAAACAGGATAAAATGTTG -3'
(R):5'- TTCACCCAAAGCTTGTTTTAAAAC -3'

Posted On

2019-06-26