Incidental Mutation 'R7164:Anapc2'
ID557777
Institutional Source Beutler Lab
Gene Symbol Anapc2
Ensembl Gene ENSMUSG00000026965
Gene Nameanaphase promoting complex subunit 2
SynonymsEmi4, 9230107K09Rik, Imi4, expressed during mesenchymal induction 4, APC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25272478-25285915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25284999 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 710 (R710C)
Ref Sequence ENSEMBL: ENSMUSP00000028341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028337] [ENSMUST00000028340] [ENSMUST00000028341]
Predicted Effect probably benign
Transcript: ENSMUST00000028337
SMART Domains Protein: ENSMUSP00000028337
Gene: ENSMUSG00000026961

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 42 75 1.86e0 SMART
LRR 72 93 7.57e0 SMART
LRR 95 117 6.96e0 SMART
LRR_TYP 118 141 1e-5 SMART
LRR 142 165 6.22e0 SMART
LRR 166 189 2.86e-1 SMART
LRRCT 201 254 3.01e-5 SMART
transmembrane domain 267 289 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028340
SMART Domains Protein: ENSMUSP00000028340
Gene: ENSMUSG00000026963

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM210 32 144 1.1e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028341
AA Change: R710C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965
AA Change: R710C

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle by ubiquitinating its specific substrates, such as mitotic cyclins and anaphase inhibitor, for subsequent degradation by the proteasome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before E6.5. Conditional ablation in the liver results in liver failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Anapc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Anapc2 APN 2 25274782 missense possibly damaging 0.65
IGL01575:Anapc2 APN 2 25285176 splice site probably benign
IGL01993:Anapc2 APN 2 25274713 missense probably benign 0.00
IGL02586:Anapc2 APN 2 25285096 missense probably benign 0.08
IGL02721:Anapc2 APN 2 25274668 nonsense probably null
FR4976:Anapc2 UTSW 2 25272532 unclassified probably benign
R0415:Anapc2 UTSW 2 25278325 missense probably damaging 1.00
R1539:Anapc2 UTSW 2 25273063 missense probably benign
R1675:Anapc2 UTSW 2 25272639 missense possibly damaging 0.88
R1720:Anapc2 UTSW 2 25274712 missense probably benign 0.13
R2150:Anapc2 UTSW 2 25272670 missense probably benign 0.27
R2173:Anapc2 UTSW 2 25273276 missense probably benign 0.01
R4028:Anapc2 UTSW 2 25277738 missense probably damaging 1.00
R4254:Anapc2 UTSW 2 25273345 missense probably benign 0.08
R4643:Anapc2 UTSW 2 25276394 missense probably benign
R4742:Anapc2 UTSW 2 25273543 splice site probably null
R4824:Anapc2 UTSW 2 25277752 missense probably damaging 1.00
R5039:Anapc2 UTSW 2 25274796 missense possibly damaging 0.70
R5530:Anapc2 UTSW 2 25284583 missense possibly damaging 0.81
R6456:Anapc2 UTSW 2 25280195 missense probably damaging 1.00
R6479:Anapc2 UTSW 2 25285395 missense probably benign 0.04
R6587:Anapc2 UTSW 2 25272538 unclassified probably benign
R7494:Anapc2 UTSW 2 25276364 missense possibly damaging 0.95
X0025:Anapc2 UTSW 2 25279278 missense probably benign 0.01
Z1088:Anapc2 UTSW 2 25273368 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAACATGCCAGATTCCCCAG -3'
(R):5'- ATGGCCAACGTACCAGTAGC -3'

Sequencing Primer
(F):5'- GGTAGCAACCATTCTTTTTACCTATG -3'
(R):5'- AACGTACCAGTAGCTCCTCTTC -3'
Posted On2019-06-26