Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Prmt6'

557783

Institutional Source

Beutler Lab

Gene Symbol

Prmt6

Ensembl Gene

ENSMUSG00000049300

Gene Name

protein arginine N-methyltransferase 6

Synonyms

Hrmt1l6

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7164 (G1)

Quality Score

189.009

Status

Validated

Chromosome

Chromosomal Location

110246109-110250998 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110250364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 203 (M203T)

Ref Sequence

ENSEMBL: ENSMUSP00000140836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106567] [ENSMUST00000168412] [ENSMUST00000190378]

AlphaFold

Q6NZB1

Predicted Effect

probably benign
Transcript: ENSMUST00000106567
AA Change: M203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102177
Gene: ENSMUSG00000049300
AA Change: M203T

Domain	Start	End	E-Value	Type
low complexity region	15	35	N/A	INTRINSIC
Pfam:PRMT5	42	347	5.3e-9	PFAM
Pfam:Met_10	50	206	6.7e-8	PFAM
Pfam:Methyltransf_9	57	218	2.6e-8	PFAM
Pfam:PrmA	70	187	1.6e-10	PFAM
Pfam:MTS	75	189	8.8e-7	PFAM
Pfam:Methyltransf_18	85	191	1.8e-8	PFAM
Pfam:Methyltransf_11	90	188	6.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168412
AA Change: M203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129801
Gene: ENSMUSG00000049300
AA Change: M203T

Domain	Start	End	E-Value	Type
low complexity region	15	35	N/A	INTRINSIC
Pfam:PRMT5	42	347	1.3e-10	PFAM
Pfam:Met_10	51	184	1.2e-7	PFAM
Pfam:Methyltransf_9	57	218	2.6e-8	PFAM
Pfam:PrmA	70	187	1.4e-10	PFAM
Pfam:MTS	75	194	5.8e-8	PFAM
Pfam:Methyltransf_18	85	192	4.2e-13	PFAM
Pfam:Methyltransf_26	86	191	6e-10	PFAM
Pfam:Methyltransf_11	90	188	5.9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190378
AA Change: M203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140836
Gene: ENSMUSG00000049300
AA Change: M203T

Domain	Start	End	E-Value	Type
low complexity region	15	35	N/A	INTRINSIC
Pfam:PRMT5	42	347	1.3e-10	PFAM
Pfam:Met_10	51	184	1.2e-7	PFAM
Pfam:Methyltransf_9	57	218	2.6e-8	PFAM
Pfam:PrmA	70	187	1.4e-10	PFAM
Pfam:MTS	75	194	5.8e-8	PFAM
Pfam:Methyltransf_18	85	192	4.2e-13	PFAM
Pfam:Methyltransf_26	86	191	6e-10	PFAM
Pfam:Methyltransf_11	90	188	5.9e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the arginine N-methyltransferase family, which catalyze the sequential transfer of methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins, to form methylated arginine derivatives and S-adenosyl-L-homocysteine. This protein can catalyze both, the formation of omega-N monomethylarginine and asymmetrical dimethylarginine, with a strong preference for the latter. It specifically mediates the asymmetric dimethylation of Arg2 of histone H3, and the methylated form represents a specific tag for epigenetic transcriptional repression. This protein also forms a complex with, and methylates DNA polymerase beta, resulting in stimulation of polymerase activity by enhancing DNA binding and processivity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mouse embryonic fibroblast proliferation and early cellular replicative senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Prmt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0029:Prmt6	UTSW	3	110249898	missense	probably benign	0.16
R0928:Prmt6	UTSW	3	110250682	missense	probably damaging	1.00
R1672:Prmt6	UTSW	3	110250571	missense	possibly damaging	0.79
R1748:Prmt6	UTSW	3	110250367	missense	probably benign
R3765:Prmt6	UTSW	3	110250194	nonsense	probably null
R3835:Prmt6	UTSW	3	110250805	missense	possibly damaging	0.75
R4027:Prmt6	UTSW	3	110249941	missense	probably damaging	0.99
R6236:Prmt6	UTSW	3	110249898	missense	probably benign	0.16
R7658:Prmt6	UTSW	3	110250385	missense	possibly damaging	0.51
R7821:Prmt6	UTSW	3	110250987	start gained	probably benign
R8178:Prmt6	UTSW	3	110250824	missense	probably damaging	1.00
R8546:Prmt6	UTSW	3	110250718	missense	possibly damaging	0.67
R8927:Prmt6	UTSW	3	110250932	missense	probably benign
R8928:Prmt6	UTSW	3	110250932	missense	probably benign
R9015:Prmt6	UTSW	3	110249898	missense	probably benign	0.16
R9755:Prmt6	UTSW	3	110250043	missense	probably damaging	1.00
Z1176:Prmt6	UTSW	3	110250130	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- CAGACGGCGAAACCATGTAG -3'
(R):5'- TCAGCATCTTCTGTGCCCAG -3'

Sequencing Primer
(F):5'- CGGAACCATAGCAGCTGCAG -3'
(R):5'- TCAACGGGTTGGAGGACC -3'

Posted On

2019-06-26