Incidental Mutation 'R7164:Prmt6'
ID 557783
Institutional Source Beutler Lab
Gene Symbol Prmt6
Ensembl Gene ENSMUSG00000049300
Gene Name protein arginine N-methyltransferase 6
Synonyms Hrmt1l6
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7164 (G1)
Quality Score 189.009
Status Validated
Chromosome 3
Chromosomal Location 110246109-110250998 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110250364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 203 (M203T)
Ref Sequence ENSEMBL: ENSMUSP00000140836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106567] [ENSMUST00000168412] [ENSMUST00000190378]
AlphaFold Q6NZB1
Predicted Effect probably benign
Transcript: ENSMUST00000106567
AA Change: M203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102177
Gene: ENSMUSG00000049300
AA Change: M203T

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 5.3e-9 PFAM
Pfam:Met_10 50 206 6.7e-8 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.6e-10 PFAM
Pfam:MTS 75 189 8.8e-7 PFAM
Pfam:Methyltransf_18 85 191 1.8e-8 PFAM
Pfam:Methyltransf_11 90 188 6.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168412
AA Change: M203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129801
Gene: ENSMUSG00000049300
AA Change: M203T

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 1.3e-10 PFAM
Pfam:Met_10 51 184 1.2e-7 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.4e-10 PFAM
Pfam:MTS 75 194 5.8e-8 PFAM
Pfam:Methyltransf_18 85 192 4.2e-13 PFAM
Pfam:Methyltransf_26 86 191 6e-10 PFAM
Pfam:Methyltransf_11 90 188 5.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190378
AA Change: M203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140836
Gene: ENSMUSG00000049300
AA Change: M203T

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 1.3e-10 PFAM
Pfam:Met_10 51 184 1.2e-7 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.4e-10 PFAM
Pfam:MTS 75 194 5.8e-8 PFAM
Pfam:Methyltransf_18 85 192 4.2e-13 PFAM
Pfam:Methyltransf_26 86 191 6e-10 PFAM
Pfam:Methyltransf_11 90 188 5.9e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the arginine N-methyltransferase family, which catalyze the sequential transfer of methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins, to form methylated arginine derivatives and S-adenosyl-L-homocysteine. This protein can catalyze both, the formation of omega-N monomethylarginine and asymmetrical dimethylarginine, with a strong preference for the latter. It specifically mediates the asymmetric dimethylation of Arg2 of histone H3, and the methylated form represents a specific tag for epigenetic transcriptional repression. This protein also forms a complex with, and methylates DNA polymerase beta, resulting in stimulation of polymerase activity by enhancing DNA binding and processivity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mouse embryonic fibroblast proliferation and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Prmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0029:Prmt6 UTSW 3 110249898 missense probably benign 0.16
R0928:Prmt6 UTSW 3 110250682 missense probably damaging 1.00
R1672:Prmt6 UTSW 3 110250571 missense possibly damaging 0.79
R1748:Prmt6 UTSW 3 110250367 missense probably benign
R3765:Prmt6 UTSW 3 110250194 nonsense probably null
R3835:Prmt6 UTSW 3 110250805 missense possibly damaging 0.75
R4027:Prmt6 UTSW 3 110249941 missense probably damaging 0.99
R6236:Prmt6 UTSW 3 110249898 missense probably benign 0.16
R7658:Prmt6 UTSW 3 110250385 missense possibly damaging 0.51
R7821:Prmt6 UTSW 3 110250987 start gained probably benign
R8178:Prmt6 UTSW 3 110250824 missense probably damaging 1.00
R8546:Prmt6 UTSW 3 110250718 missense possibly damaging 0.67
R8927:Prmt6 UTSW 3 110250932 missense probably benign
R8928:Prmt6 UTSW 3 110250932 missense probably benign
R9015:Prmt6 UTSW 3 110249898 missense probably benign 0.16
R9755:Prmt6 UTSW 3 110250043 missense probably damaging 1.00
Z1176:Prmt6 UTSW 3 110250130 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAGACGGCGAAACCATGTAG -3'
(R):5'- TCAGCATCTTCTGTGCCCAG -3'

Sequencing Primer
(F):5'- CGGAACCATAGCAGCTGCAG -3'
(R):5'- TCAACGGGTTGGAGGACC -3'
Posted On 2019-06-26