Incidental Mutation 'R7164:Manba'
ID557784
Institutional Source Beutler Lab
Gene Symbol Manba
Ensembl Gene ENSMUSG00000028164
Gene Namemannosidase, beta A, lysosomal
SynonymsB930014J03Rik, Bmn, 2410030O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135485611-135571404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135542388 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 346 (N346I)
Ref Sequence ENSEMBL: ENSMUSP00000029814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]
Predicted Effect probably damaging
Transcript: ENSMUST00000029814
AA Change: N346I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: N346I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 42 211 6.5e-11 PFAM
Pfam:Glyco_hydro_2_C 340 595 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131610
SMART Domains Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 22 163 1.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Manba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Manba APN 3 135554780 nonsense probably null
IGL01443:Manba APN 3 135544828 missense probably damaging 1.00
IGL01796:Manba APN 3 135542389 missense probably damaging 1.00
IGL02396:Manba APN 3 135544764 missense probably damaging 1.00
IGL02471:Manba APN 3 135507008 splice site probably benign
IGL02809:Manba APN 3 135547560 missense probably damaging 1.00
IGL02861:Manba APN 3 135570263 missense probably benign 0.03
IGL02934:Manba APN 3 135544749 missense probably benign 0.00
IGL03130:Manba APN 3 135551159 missense probably damaging 1.00
IGL03237:Manba APN 3 135544751 missense probably damaging 1.00
IGL03342:Manba APN 3 135517987 missense possibly damaging 0.51
R0551:Manba UTSW 3 135517973 missense probably damaging 0.98
R1549:Manba UTSW 3 135544806 missense probably damaging 1.00
R1752:Manba UTSW 3 135506945 missense probably damaging 1.00
R1932:Manba UTSW 3 135544740 missense probably benign 0.01
R1991:Manba UTSW 3 135551191 missense probably benign 0.05
R3729:Manba UTSW 3 135554850 missense probably benign 0.00
R3731:Manba UTSW 3 135554850 missense probably benign 0.00
R3813:Manba UTSW 3 135563262 missense possibly damaging 0.67
R4712:Manba UTSW 3 135544814 missense probably damaging 1.00
R5001:Manba UTSW 3 135567630 missense probably benign 0.00
R5481:Manba UTSW 3 135524556 missense possibly damaging 0.86
R5889:Manba UTSW 3 135524598 nonsense probably null
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6434:Manba UTSW 3 135511973 splice site probably null
R6760:Manba UTSW 3 135542451 missense probably damaging 0.98
R7182:Manba UTSW 3 135567513 missense probably benign 0.06
R7184:Manba UTSW 3 135523154 missense possibly damaging 0.62
R7212:Manba UTSW 3 135567635 missense probably benign
R7266:Manba UTSW 3 135517912 missense probably damaging 1.00
R7271:Manba UTSW 3 135542376 missense probably damaging 1.00
R7466:Manba UTSW 3 135542393 missense probably benign 0.13
R7467:Manba UTSW 3 135544801 missense probably damaging 1.00
R7542:Manba UTSW 3 135566593 missense probably benign 0.10
R7546:Manba UTSW 3 135570246 missense probably benign 0.01
R7726:Manba UTSW 3 135518009 missense probably benign 0.14
Z1176:Manba UTSW 3 135563274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATGTACATATGGTGTGTTTGTACA -3'
(R):5'- TCCAGTCCTTCTGCTGGGA -3'

Sequencing Primer
(F):5'- GTTCTCGTGAGACAGAATCACTC -3'
(R):5'- CATACTCACCGATCGGAA -3'
Posted On2019-06-26