Incidental Mutation 'R7164:Olfr1331'
ID 557789
Institutional Source Beutler Lab
Gene Symbol Olfr1331
Ensembl Gene ENSMUSG00000073769
Gene Name olfactory receptor 1331
Synonyms MOR259-3P, GA_x6K02T2QD9B-18670866-18669913
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7164 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118864649-118871707 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118869725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 315 (P315S)
Ref Sequence ENSEMBL: ENSMUSP00000101967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094831] [ENSMUST00000106360] [ENSMUST00000216589]
AlphaFold K7N684
Predicted Effect probably benign
Transcript: ENSMUST00000094831
AA Change: P315S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092426
Gene: ENSMUSG00000073769
AA Change: P315S

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.1e-53 PFAM
Pfam:7tm_1 42 291 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106360
AA Change: P315S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101967
Gene: ENSMUSG00000073769
AA Change: P315S

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.2e-28 PFAM
Pfam:7tm_4 139 283 2.8e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216589
AA Change: P314S

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Olfr1331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Olfr1331 APN 4 118869287 missense probably damaging 1.00
IGL01314:Olfr1331 APN 4 118869131 missense probably benign 0.26
IGL02025:Olfr1331 APN 4 118869165 missense probably damaging 1.00
IGL02458:Olfr1331 APN 4 118869300 missense possibly damaging 0.83
IGL02793:Olfr1331 APN 4 118869597 missense probably damaging 1.00
IGL02827:Olfr1331 APN 4 118868960 missense probably damaging 0.99
IGL02863:Olfr1331 APN 4 118868886 missense possibly damaging 0.52
IGL03125:Olfr1331 APN 4 118868921 missense possibly damaging 0.95
R0078:Olfr1331 UTSW 4 118869227 missense probably benign
R0152:Olfr1331 UTSW 4 118868886 missense possibly damaging 0.89
R0299:Olfr1331 UTSW 4 118869416 missense probably benign 0.00
R3881:Olfr1331 UTSW 4 118869353 missense probably benign 0.00
R3928:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R3929:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R5288:Olfr1331 UTSW 4 118869575 missense probably damaging 1.00
R5552:Olfr1331 UTSW 4 118869468 missense probably damaging 1.00
R5672:Olfr1331 UTSW 4 118869182 missense possibly damaging 0.83
R5773:Olfr1331 UTSW 4 118869521 missense probably damaging 0.97
R6117:Olfr1331 UTSW 4 118869144 missense probably benign 0.39
R6910:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6911:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6912:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R7446:Olfr1331 UTSW 4 118868822 missense possibly damaging 0.83
R9747:Olfr1331 UTSW 4 118869020 missense probably damaging 1.00
T0975:Olfr1331 UTSW 4 118869303 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTACTTGAGGCCCAACTCC -3'
(R):5'- CTAATGAAAGTGAGCCCCAAGG -3'

Sequencing Primer
(F):5'- TCCAGTTACTCCCCTGAGAGAG -3'
(R):5'- GAGTCTTTGCATGCAGAATCAG -3'
Posted On 2019-06-26