Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Masp2'

557790

Institutional Source

Beutler Lab

Gene Symbol

Masp2

Ensembl Gene

ENSMUSG00000028979

Gene Name

mannan-binding lectin serine peptidase 2

Synonyms

MASP-2, MAp19

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148602554-148615499 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 148610115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000049729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000105702] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000186729] [ENSMUST00000188134]

AlphaFold

Q91WP0

Predicted Effect

probably null
Transcript: ENSMUST00000052060

SMART Domains

Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979

Domain	Start	End	E-Value	Type
CUB	18	137	4.71e-30	SMART
EGF_CA	138	181	4.32e-10	SMART
CUB	184	296	4.29e-33	SMART
CCP	300	361	1.79e-12	SMART
CCP	366	429	5.4e-7	SMART
Tryp_SPc	443	678	1.3e-82	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084125

SMART Domains

Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART
low complexity region	273	316	N/A	INTRINSIC
low complexity region	321	329	N/A	INTRINSIC
low complexity region	342	358	N/A	INTRINSIC
low complexity region	368	380	N/A	INTRINSIC
low complexity region	386	404	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105702

SMART Domains

Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165113

SMART Domains

Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172073

SMART Domains

Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART
low complexity region	274	285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186729

SMART Domains

Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
Pfam:RRM_1	1	37	1.8e-4	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188134

SMART Domains

Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188488

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Masp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Masp2	APN	4	148602729	missense	probably benign	0.05
IGL01284:Masp2	APN	4	148614007	missense	probably damaging	1.00
IGL02040:Masp2	APN	4	148603813	missense	probably damaging	1.00
IGL02243:Masp2	APN	4	148603068	missense	probably benign	0.32
IGL02490:Masp2	APN	4	148607943	missense	possibly damaging	0.91
IGL02517:Masp2	APN	4	148614020	missense	probably damaging	1.00
IGL02997:Masp2	APN	4	148603175	splice site	probably benign
R0408:Masp2	UTSW	4	148606039	missense	probably benign
R1517:Masp2	UTSW	4	148612106	missense	possibly damaging	0.74
R1630:Masp2	UTSW	4	148614033	missense	probably benign	0.07
R1634:Masp2	UTSW	4	148614355	missense	probably damaging	1.00
R1873:Masp2	UTSW	4	148614495	missense	probably damaging	1.00
R2208:Masp2	UTSW	4	148614415	missense	probably damaging	1.00
R2283:Masp2	UTSW	4	148606068	missense	probably benign	0.00
R2876:Masp2	UTSW	4	148608001	missense	probably benign
R3921:Masp2	UTSW	4	148605731	missense	possibly damaging	0.95
R4586:Masp2	UTSW	4	148613901	missense	probably damaging	1.00
R4753:Masp2	UTSW	4	148612151	missense	probably benign	0.00
R4877:Masp2	UTSW	4	148602871	missense	probably benign	0.00
R5169:Masp2	UTSW	4	148606114	missense	probably damaging	0.96
R5512:Masp2	UTSW	4	148614069	missense	probably damaging	1.00
R6161:Masp2	UTSW	4	148614012	missense	possibly damaging	0.88
R6291:Masp2	UTSW	4	148602753	missense	probably damaging	0.99
R7039:Masp2	UTSW	4	148602586	start codon destroyed	probably benign	0.03
R7183:Masp2	UTSW	4	148612157	missense	probably benign	0.02
R7417:Masp2	UTSW	4	148605721	missense	probably benign	0.02
R7718:Masp2	UTSW	4	148602747	missense	probably damaging	1.00
R7748:Masp2	UTSW	4	148605706	missense	probably benign	0.00
R7852:Masp2	UTSW	4	148602732	missense	probably benign	0.00
R7986:Masp2	UTSW	4	148602826	missense	probably damaging	1.00
R8078:Masp2	UTSW	4	148613778	missense	probably benign	0.01
R8203:Masp2	UTSW	4	148612142	missense	probably benign	0.00
R8257:Masp2	UTSW	4	148603040	missense	possibly damaging	0.82
R8465:Masp2	UTSW	4	148612059	missense	possibly damaging	0.79
R9324:Masp2	UTSW	4	148608028	missense	possibly damaging	0.65
R9350:Masp2	UTSW	4	148607939	critical splice acceptor site	probably null
R9706:Masp2	UTSW	4	148612140	missense	probably benign	0.03
X0025:Masp2	UTSW	4	148602723	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATTTATGCATAAAAGGCCACCACAG -3'
(R):5'- AATGTCAGGCTCCTGCTGAC -3'

Sequencing Primer
(F):5'- GGCCACCACAGTTAAAACAGAAG -3'
(R):5'- CTAAAATTTCATGGCTGGGGTCAC -3'

Posted On

2019-06-26