Incidental Mutation 'R7164:Masp2'
ID 557790
Institutional Source Beutler Lab
Gene Symbol Masp2
Ensembl Gene ENSMUSG00000028979
Gene Name MBL associated serine protease 2
Synonyms MAp19, MASP-2
MMRRC Submission 045331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R7164 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 148687011-148699956 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 148694572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000105702] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000186729] [ENSMUST00000188134]
AlphaFold Q91WP0
Predicted Effect probably null
Transcript: ENSMUST00000052060
SMART Domains Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
CUB 184 296 4.29e-33 SMART
CCP 300 361 1.79e-12 SMART
CCP 366 429 5.4e-7 SMART
Tryp_SPc 443 678 1.3e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084125
SMART Domains Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 273 316 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105702
SMART Domains Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165113
SMART Domains Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172073
SMART Domains Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186729
SMART Domains Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Pfam:RRM_1 1 37 1.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188134
SMART Domains Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188488
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 G A 13: 12,293,847 (GRCm39) H558Y probably damaging Het
Ajm1 T A 2: 25,468,579 (GRCm39) H444L possibly damaging Het
Akap9 G C 5: 4,110,364 (GRCm39) E3022D probably damaging Het
Anapc2 C T 2: 25,175,011 (GRCm39) R710C probably damaging Het
Bcl6 G A 16: 23,784,976 (GRCm39) R675* probably null Het
Carmil3 A G 14: 55,738,739 (GRCm39) E844G probably damaging Het
Cdk17 T G 10: 93,068,343 (GRCm39) S367A probably benign Het
Cfap206 T A 4: 34,719,656 (GRCm39) M253L probably benign Het
Chd3 T G 11: 69,253,132 (GRCm39) K228Q probably damaging Het
Cit T A 5: 116,123,846 (GRCm39) I1503N possibly damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Czib C A 4: 107,752,087 (GRCm39) D155E not run Het
Degs1 A G 1: 182,106,690 (GRCm39) S226P probably damaging Het
Espl1 T C 15: 102,221,638 (GRCm39) W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 (GRCm39) P275L probably benign Het
Flnb A G 14: 7,915,944 (GRCm38) probably null Het
Gnptab T A 10: 88,269,932 (GRCm39) Y878* probably null Het
Gpr89 A T 3: 96,778,714 (GRCm39) M453K probably benign Het
Igsf5 A T 16: 96,174,048 (GRCm39) Q26L possibly damaging Het
Inpp5e T A 2: 26,297,995 (GRCm39) D202V possibly damaging Het
Itga3 C T 11: 94,943,305 (GRCm39) V931M possibly damaging Het
Kcnab3 T C 11: 69,222,184 (GRCm39) probably null Het
Klk4 T C 7: 43,531,122 (GRCm39) I17T possibly damaging Het
Lrrc73 T C 17: 46,567,169 (GRCm39) L206P probably damaging Het
Manba A T 3: 135,248,149 (GRCm39) N346I probably damaging Het
Map4k4 T C 1: 40,013,132 (GRCm39) Y76H possibly damaging Het
Map4k5 T C 12: 69,877,210 (GRCm39) T312A probably benign Het
Mast1 T C 8: 85,661,933 (GRCm39) D63G possibly damaging Het
Mtf2 T A 5: 108,241,235 (GRCm39) S254T possibly damaging Het
Myo16 A T 8: 10,619,585 (GRCm39) T1379S unknown Het
Myo5a A G 9: 75,087,435 (GRCm39) E1097G probably benign Het
Nat1 T C 8: 67,944,329 (GRCm39) V238A possibly damaging Het
Nhlrc2 A G 19: 56,580,931 (GRCm39) D493G probably damaging Het
Or10ak9 C T 4: 118,726,922 (GRCm39) P315S probably benign Het
Or1j21 T C 2: 36,683,709 (GRCm39) S154P probably benign Het
Or5ae2 A G 7: 84,506,251 (GRCm39) I227V possibly damaging Het
Or5b108 A T 19: 13,168,270 (GRCm39) M80L probably benign Het
Or5d20-ps1 T C 2: 87,932,176 (GRCm39) K52E probably damaging Het
Or8g51 A G 9: 38,609,515 (GRCm39) I49T possibly damaging Het
Pcsk5 C T 19: 17,429,349 (GRCm39) C1543Y probably damaging Het
Pde4d A G 13: 109,169,222 (GRCm39) D88G probably benign Het
Pld5 A T 1: 176,041,187 (GRCm39) M1K probably null Het
Prmt6 A G 3: 110,157,680 (GRCm39) M203T probably benign Het
Prr14l A T 5: 32,986,510 (GRCm39) V995D probably damaging Het
Psg18 T C 7: 18,084,862 (GRCm39) E199G possibly damaging Het
Pth1r A G 9: 110,552,815 (GRCm39) I439T possibly damaging Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Slc44a1 T C 4: 53,528,711 (GRCm39) S154P probably benign Het
Slco1c1 T A 6: 141,487,855 (GRCm39) Y192* probably null Het
Spag16 A G 1: 70,764,025 (GRCm39) H615R possibly damaging Het
Spata31h1 G A 10: 82,122,063 (GRCm39) T3649I probably damaging Het
Tas2r114 G A 6: 131,666,728 (GRCm39) A100V possibly damaging Het
U2af1l4 T C 7: 30,264,544 (GRCm39) S103P probably benign Het
Usp10 T C 8: 120,668,847 (GRCm39) S383P probably damaging Het
Vmn2r113 A G 17: 23,167,137 (GRCm39) R505G probably benign Het
Vmn2r75 A C 7: 85,814,592 (GRCm39) D300E probably damaging Het
Zfp318 T A 17: 46,708,232 (GRCm39) probably null Het
Zfp318 T C 17: 46,716,865 (GRCm39) V999A probably damaging Het
Zfp324 A T 7: 12,702,810 (GRCm39) H58L probably damaging Het
Zfp707 A G 15: 75,846,967 (GRCm39) E339G possibly damaging Het
Other mutations in Masp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Masp2 APN 4 148,687,186 (GRCm39) missense probably benign 0.05
IGL01284:Masp2 APN 4 148,698,464 (GRCm39) missense probably damaging 1.00
IGL02040:Masp2 APN 4 148,688,270 (GRCm39) missense probably damaging 1.00
IGL02243:Masp2 APN 4 148,687,525 (GRCm39) missense probably benign 0.32
IGL02490:Masp2 APN 4 148,692,400 (GRCm39) missense possibly damaging 0.91
IGL02517:Masp2 APN 4 148,698,477 (GRCm39) missense probably damaging 1.00
IGL02997:Masp2 APN 4 148,687,632 (GRCm39) splice site probably benign
R0408:Masp2 UTSW 4 148,690,496 (GRCm39) missense probably benign
R1517:Masp2 UTSW 4 148,696,563 (GRCm39) missense possibly damaging 0.74
R1630:Masp2 UTSW 4 148,698,490 (GRCm39) missense probably benign 0.07
R1634:Masp2 UTSW 4 148,698,812 (GRCm39) missense probably damaging 1.00
R1873:Masp2 UTSW 4 148,698,952 (GRCm39) missense probably damaging 1.00
R2208:Masp2 UTSW 4 148,698,872 (GRCm39) missense probably damaging 1.00
R2283:Masp2 UTSW 4 148,690,525 (GRCm39) missense probably benign 0.00
R2876:Masp2 UTSW 4 148,692,458 (GRCm39) missense probably benign
R3921:Masp2 UTSW 4 148,690,188 (GRCm39) missense possibly damaging 0.95
R4586:Masp2 UTSW 4 148,698,358 (GRCm39) missense probably damaging 1.00
R4753:Masp2 UTSW 4 148,696,608 (GRCm39) missense probably benign 0.00
R4877:Masp2 UTSW 4 148,687,328 (GRCm39) missense probably benign 0.00
R5169:Masp2 UTSW 4 148,690,571 (GRCm39) missense probably damaging 0.96
R5512:Masp2 UTSW 4 148,698,526 (GRCm39) missense probably damaging 1.00
R6161:Masp2 UTSW 4 148,698,469 (GRCm39) missense possibly damaging 0.88
R6291:Masp2 UTSW 4 148,687,210 (GRCm39) missense probably damaging 0.99
R7039:Masp2 UTSW 4 148,687,043 (GRCm39) start codon destroyed probably benign 0.03
R7183:Masp2 UTSW 4 148,696,614 (GRCm39) missense probably benign 0.02
R7417:Masp2 UTSW 4 148,690,178 (GRCm39) missense probably benign 0.02
R7718:Masp2 UTSW 4 148,687,204 (GRCm39) missense probably damaging 1.00
R7748:Masp2 UTSW 4 148,690,163 (GRCm39) missense probably benign 0.00
R7852:Masp2 UTSW 4 148,687,189 (GRCm39) missense probably benign 0.00
R7986:Masp2 UTSW 4 148,687,283 (GRCm39) missense probably damaging 1.00
R8078:Masp2 UTSW 4 148,698,235 (GRCm39) missense probably benign 0.01
R8203:Masp2 UTSW 4 148,696,599 (GRCm39) missense probably benign 0.00
R8257:Masp2 UTSW 4 148,687,497 (GRCm39) missense possibly damaging 0.82
R8465:Masp2 UTSW 4 148,696,516 (GRCm39) missense possibly damaging 0.79
R9324:Masp2 UTSW 4 148,692,485 (GRCm39) missense possibly damaging 0.65
R9350:Masp2 UTSW 4 148,692,396 (GRCm39) critical splice acceptor site probably null
R9706:Masp2 UTSW 4 148,696,597 (GRCm39) missense probably benign 0.03
X0025:Masp2 UTSW 4 148,687,180 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTATGCATAAAAGGCCACCACAG -3'
(R):5'- AATGTCAGGCTCCTGCTGAC -3'

Sequencing Primer
(F):5'- GGCCACCACAGTTAAAACAGAAG -3'
(R):5'- CTAAAATTTCATGGCTGGGGTCAC -3'
Posted On 2019-06-26