Incidental Mutation 'R7164:Masp2'
ID557790
Institutional Source Beutler Lab
Gene Symbol Masp2
Ensembl Gene ENSMUSG00000028979
Gene Namemannan-binding lectin serine peptidase 2
SynonymsMASP-2, MAp19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148602554-148615499 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 148610115 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000105702] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000186729] [ENSMUST00000188134]
Predicted Effect probably null
Transcript: ENSMUST00000052060
SMART Domains Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
CUB 184 296 4.29e-33 SMART
CCP 300 361 1.79e-12 SMART
CCP 366 429 5.4e-7 SMART
Tryp_SPc 443 678 1.3e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084125
SMART Domains Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 273 316 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105702
SMART Domains Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165113
SMART Domains Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172073
SMART Domains Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186729
SMART Domains Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Pfam:RRM_1 1 37 1.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188134
SMART Domains Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188488
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Masp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Masp2 APN 4 148602729 missense probably benign 0.05
IGL01284:Masp2 APN 4 148614007 missense probably damaging 1.00
IGL02040:Masp2 APN 4 148603813 missense probably damaging 1.00
IGL02243:Masp2 APN 4 148603068 missense probably benign 0.32
IGL02490:Masp2 APN 4 148607943 missense possibly damaging 0.91
IGL02517:Masp2 APN 4 148614020 missense probably damaging 1.00
IGL02997:Masp2 APN 4 148603175 splice site probably benign
R0408:Masp2 UTSW 4 148606039 missense probably benign
R1517:Masp2 UTSW 4 148612106 missense possibly damaging 0.74
R1630:Masp2 UTSW 4 148614033 missense probably benign 0.07
R1634:Masp2 UTSW 4 148614355 missense probably damaging 1.00
R1873:Masp2 UTSW 4 148614495 missense probably damaging 1.00
R2208:Masp2 UTSW 4 148614415 missense probably damaging 1.00
R2283:Masp2 UTSW 4 148606068 missense probably benign 0.00
R2876:Masp2 UTSW 4 148608001 missense probably benign
R3921:Masp2 UTSW 4 148605731 missense possibly damaging 0.95
R4586:Masp2 UTSW 4 148613901 missense probably damaging 1.00
R4753:Masp2 UTSW 4 148612151 missense probably benign 0.00
R4877:Masp2 UTSW 4 148602871 missense probably benign 0.00
R5169:Masp2 UTSW 4 148606114 missense probably damaging 0.96
R5512:Masp2 UTSW 4 148614069 missense probably damaging 1.00
R6161:Masp2 UTSW 4 148614012 missense possibly damaging 0.88
R6291:Masp2 UTSW 4 148602753 missense probably damaging 0.99
R7039:Masp2 UTSW 4 148602586 start codon destroyed probably benign 0.03
R7183:Masp2 UTSW 4 148612157 missense probably benign 0.02
R7417:Masp2 UTSW 4 148605721 missense probably benign 0.02
R7718:Masp2 UTSW 4 148602747 missense probably damaging 1.00
R7748:Masp2 UTSW 4 148605706 missense probably benign 0.00
R7852:Masp2 UTSW 4 148602732 missense probably benign 0.00
R7986:Masp2 UTSW 4 148602826 missense probably damaging 1.00
R8078:Masp2 UTSW 4 148613778 missense probably benign 0.01
R8203:Masp2 UTSW 4 148612142 missense probably benign 0.00
R8257:Masp2 UTSW 4 148603040 missense possibly damaging 0.82
X0025:Masp2 UTSW 4 148602723 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTATGCATAAAAGGCCACCACAG -3'
(R):5'- AATGTCAGGCTCCTGCTGAC -3'

Sequencing Primer
(F):5'- GGCCACCACAGTTAAAACAGAAG -3'
(R):5'- CTAAAATTTCATGGCTGGGGTCAC -3'
Posted On2019-06-26