Incidental Mutation 'R7164:Mtf2'
ID557794
Institutional Source Beutler Lab
Gene Symbol Mtf2
Ensembl Gene ENSMUSG00000029267
Gene Namemetal response element binding transcription factor 2
SynonymsPcl2, C76717, 9230112N11Rik, M96
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108065674-108109004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108093369 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 254 (S254T)
Ref Sequence ENSEMBL: ENSMUSP00000080278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081567] [ENSMUST00000112626] [ENSMUST00000124195] [ENSMUST00000134026] [ENSMUST00000143412] [ENSMUST00000170319]
PDB Structure
Solution structure of the TUDOR domain of Metal-response element-binding transcription factor 2 [SOLUTION NMR]
Solution structure of the PHD domain of Metal-response element-binding transcription factor 2 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081567
AA Change: S254T

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080278
Gene: ENSMUSG00000029267
AA Change: S254T

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 496 508 N/A INTRINSIC
Pfam:Mtf2_C 544 591 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112626
AA Change: S254T

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108245
Gene: ENSMUSG00000029267
AA Change: S254T

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 439 451 N/A INTRINSIC
Pfam:Mtf2_C 485 535 5.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124195
SMART Domains Protein: ENSMUSP00000126297
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PDB:2EQJ|A 36 70 2e-17 PDB
Blast:TUDOR 44 75 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129921
AA Change: S28T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably damaging
Transcript: ENSMUST00000134026
AA Change: S254T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128797
Gene: ENSMUSG00000029267
AA Change: S254T

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137996
AA Change: S159T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121697
Gene: ENSMUSG00000029267
AA Change: S159T

DomainStartEndE-ValueType
PHD 10 61 3.37e-11 SMART
PHD 109 159 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143412
SMART Domains Protein: ENSMUSP00000132596
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
TUDOR 44 101 1.22e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170319
AA Change: S136T

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130536
Gene: ENSMUSG00000029267
AA Change: S136T

DomainStartEndE-ValueType
PHD 1 37 6.4e-3 SMART
PHD 85 135 1.23e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vertebral transformation and delayed replicative senescence in MEFs. Mice homozygous for one gene trap allele exhibit postnatal lethality, vertebral transformation and delayed replicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Mtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Mtf2 APN 5 108106890 missense probably damaging 1.00
IGL01367:Mtf2 APN 5 108104457 missense probably benign 0.44
IGL01452:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01459:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01460:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01809:Mtf2 APN 5 108087325 missense probably benign 0.27
IGL03166:Mtf2 APN 5 108106720 missense probably benign 0.28
R0667:Mtf2 UTSW 5 108104503 missense probably damaging 1.00
R1533:Mtf2 UTSW 5 108092129 missense probably damaging 1.00
R1664:Mtf2 UTSW 5 108104476 missense probably damaging 1.00
R1723:Mtf2 UTSW 5 108088070 missense probably damaging 1.00
R2154:Mtf2 UTSW 5 108080931 missense possibly damaging 0.79
R2213:Mtf2 UTSW 5 108100914 missense possibly damaging 0.95
R3904:Mtf2 UTSW 5 108081000 missense probably damaging 1.00
R4320:Mtf2 UTSW 5 108087025 missense probably damaging 1.00
R4560:Mtf2 UTSW 5 108086989 splice site probably null
R4764:Mtf2 UTSW 5 108093352 missense probably benign 0.43
R4989:Mtf2 UTSW 5 108073028 intron probably benign
R5305:Mtf2 UTSW 5 108104499 missense possibly damaging 0.84
R5356:Mtf2 UTSW 5 108106610 missense possibly damaging 0.92
R5528:Mtf2 UTSW 5 108094157 missense probably damaging 1.00
R6021:Mtf2 UTSW 5 108081137 missense possibly damaging 0.93
R7426:Mtf2 UTSW 5 108100970 missense probably benign
R7822:Mtf2 UTSW 5 108080877 nonsense probably null
R8033:Mtf2 UTSW 5 108087085 missense probably damaging 0.99
Z1088:Mtf2 UTSW 5 108087329 missense probably damaging 0.97
Z1176:Mtf2 UTSW 5 108087944 missense probably damaging 1.00
Z1177:Mtf2 UTSW 5 108065902 start gained probably benign
Z1177:Mtf2 UTSW 5 108080888 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGAAATTGTCCCTTACCCCTAGATAG -3'
(R):5'- TGGTTAAATGGATAATCCTGAAGCC -3'

Sequencing Primer
(F):5'- CCTTACCCCTAGATAGGAATTGTTGG -3'
(R):5'- TCCTGAAGCCAGTATAAGCCTTGAG -3'
Posted On2019-06-26