Mutagenetix > Incidental Mutations

Incidental Mutation 'R7164:Tas2r114'

557796

Institutional Source

Beutler Lab

Gene Symbol

Tas2r114

Ensembl Gene

ENSMUSG00000063478

Gene Name

taste receptor, type 2, member 114

Synonyms

mt2r46, mGR14, T2R14, Tas2r14

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131689134-131690063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 131689765 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 100 (A100V)

Ref Sequence

ENSEMBL: ENSMUSP00000079453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]

Predicted Effect

probably benign
Transcript: ENSMUST00000053652

SMART Domains

Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	9.4e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000072404

SMART Domains

Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.3e-102	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080619
AA Change: A100V

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: A100V

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.1e-104	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Tas2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Tas2r114	APN	6	131689701	nonsense	probably null
IGL02971:Tas2r114	APN	6	131689280	missense	probably benign	0.00
R0561:Tas2r114	UTSW	6	131689795	missense	probably benign	0.30
R3034:Tas2r114	UTSW	6	131689648	missense	probably benign	0.15
R3687:Tas2r114	UTSW	6	131689268	missense	probably benign	0.25
R4411:Tas2r114	UTSW	6	131689622	missense	probably benign	0.06
R4826:Tas2r114	UTSW	6	131689837	missense	probably damaging	0.99
R4889:Tas2r114	UTSW	6	131689795	missense	probably damaging	0.96
R5084:Tas2r114	UTSW	6	131689288	nonsense	probably null
R5258:Tas2r114	UTSW	6	131689541	missense	probably benign	0.03
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6499:Tas2r114	UTSW	6	131689136	makesense	probably null
R7276:Tas2r114	UTSW	6	131689347	missense	probably damaging	0.96
R7745:Tas2r114	UTSW	6	131689438	missense	probably damaging	1.00
R7851:Tas2r114	UTSW	6	131689925	missense	probably damaging	1.00
R7934:Tas2r114	UTSW	6	131689925	missense	probably damaging	1.00
R8002:Tas2r114	UTSW	6	131689139	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCCAAGATGTGTTTATATACAGC -3'
(R):5'- CTGGGCATTGTAGGGAACAC -3'

Sequencing Primer
(F):5'- AGCACCCTATCAGGAAGA -3'
(R):5'- GGGAACACATTCATTGCACTTG -3'

Posted On

2019-06-26