Incidental Mutation 'R7164:Slco1c1'
ID557797
Institutional Source Beutler Lab
Gene Symbol Slco1c1
Ensembl Gene ENSMUSG00000030235
Gene Namesolute carrier organic anion transporter family, member 1c1
SynonymsSlc21a14, OATP-F
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141524368-141570177 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 141542129 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 192 (Y192*)
Ref Sequence ENSEMBL: ENSMUSP00000032362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032362] [ENSMUST00000135562] [ENSMUST00000203140] [ENSMUST00000204998] [ENSMUST00000205214]
Predicted Effect probably null
Transcript: ENSMUST00000032362
AA Change: Y192*
SMART Domains Protein: ENSMUSP00000032362
Gene: ENSMUSG00000030235
AA Change: Y192*

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
low complexity region 152 168 N/A INTRINSIC
Pfam:MFS_1 181 464 1.1e-19 PFAM
KAZAL 478 518 1.21e0 SMART
transmembrane domain 644 666 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135562
AA Change: Y192*
SMART Domains Protein: ENSMUSP00000138093
Gene: ENSMUSG00000030235
AA Change: Y192*

DomainStartEndE-ValueType
Pfam:OATP 42 469 2.1e-135 PFAM
Pfam:Sugar_tr 175 460 2.9e-7 PFAM
Pfam:MFS_1 181 463 3.8e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203140
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000145058
Gene: ENSMUSG00000030235
AA Change: Y74*

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
Pfam:MFS_1 63 346 2e-18 PFAM
KAZAL 360 400 7.8e-3 SMART
transmembrane domain 437 459 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204998
Predicted Effect probably benign
Transcript: ENSMUST00000205214
SMART Domains Protein: ENSMUSP00000144889
Gene: ENSMUSG00000030235

DomainStartEndE-ValueType
Pfam:OATP 44 176 1.3e-35 PFAM
Pfam:MFS_1 169 415 1.1e-10 PFAM
KAZAL 429 469 7.8e-3 SMART
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of thyroid hormones in brain tissues. This protein has particularly high affinity for the thyroid hormones thyroxine, tri-iodothyronine and reverse tri-iodothyronine. Polymorphisms in the gene encoding this protein may be associated with fatigue and depression in patients suffering from hyperthyroidism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thyroxine and triiodothyronine levels in the forebrain, in the absence of overt growth, reproductive or neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Slco1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Slco1c1 APN 6 141569482 missense probably benign 0.00
IGL00766:Slco1c1 APN 6 141547883 missense probably damaging 1.00
IGL00825:Slco1c1 APN 6 141542142 missense probably damaging 1.00
IGL01380:Slco1c1 APN 6 141540051 missense probably damaging 1.00
IGL01583:Slco1c1 APN 6 141540067 missense probably damaging 1.00
IGL01877:Slco1c1 APN 6 141555153 missense probably damaging 0.98
IGL02601:Slco1c1 APN 6 141544829 missense probably damaging 1.00
IGL02852:Slco1c1 APN 6 141547824 nonsense probably null
IGL03058:Slco1c1 APN 6 141563187 missense probably benign 0.44
IGL03102:Slco1c1 APN 6 141544827 missense possibly damaging 0.63
R0101:Slco1c1 UTSW 6 141531510 missense probably damaging 0.99
R0326:Slco1c1 UTSW 6 141559773 missense probably benign 0.45
R0755:Slco1c1 UTSW 6 141531532 missense probably damaging 0.99
R1335:Slco1c1 UTSW 6 141542127 missense probably damaging 1.00
R2011:Slco1c1 UTSW 6 141555107 missense probably benign 0.00
R2084:Slco1c1 UTSW 6 141559852 nonsense probably null
R2163:Slco1c1 UTSW 6 141559752 missense probably benign 0.25
R2190:Slco1c1 UTSW 6 141563167 missense probably benign 0.02
R2248:Slco1c1 UTSW 6 141546689 missense probably damaging 1.00
R2876:Slco1c1 UTSW 6 141559856 missense probably damaging 1.00
R3004:Slco1c1 UTSW 6 141532654 missense probably damaging 1.00
R3196:Slco1c1 UTSW 6 141531448 splice site probably null
R4444:Slco1c1 UTSW 6 141546691 missense possibly damaging 0.96
R4529:Slco1c1 UTSW 6 141555181 missense probably damaging 1.00
R4743:Slco1c1 UTSW 6 141564516 missense probably damaging 0.98
R5261:Slco1c1 UTSW 6 141546776 missense probably damaging 1.00
R5451:Slco1c1 UTSW 6 141559878 missense probably benign 0.04
R5558:Slco1c1 UTSW 6 141567496 missense probably damaging 0.97
R5813:Slco1c1 UTSW 6 141542203 missense probably damaging 1.00
R5836:Slco1c1 UTSW 6 141569314 missense probably damaging 1.00
R6084:Slco1c1 UTSW 6 141546770 missense probably benign 0.02
R6434:Slco1c1 UTSW 6 141547850 missense probably damaging 1.00
R6544:Slco1c1 UTSW 6 141531444 splice site probably null
R6766:Slco1c1 UTSW 6 141547809 missense possibly damaging 0.49
R6865:Slco1c1 UTSW 6 141540052 missense probably damaging 1.00
R7050:Slco1c1 UTSW 6 141547926 missense probably damaging 1.00
R7255:Slco1c1 UTSW 6 141569325 missense probably benign 0.07
R7362:Slco1c1 UTSW 6 141569463 missense probably benign 0.00
R7696:Slco1c1 UTSW 6 141567610 missense probably benign 0.01
R8316:Slco1c1 UTSW 6 141546914 missense probably benign 0.03
X0061:Slco1c1 UTSW 6 141532739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGGCTCACTCAAACGC -3'
(R):5'- CTCCCAGTTAACTGAAGCAAGGG -3'

Sequencing Primer
(F):5'- ACGCTTATCAGATTAGCACTGTGG -3'
(R):5'- GGACTGAGTGCTCAAAACTTCCATG -3'
Posted On2019-06-26