Incidental Mutation 'R7164:Zfp324'
ID557798
Institutional Source Beutler Lab
Gene Symbol Zfp324
Ensembl Gene ENSMUSG00000004500
Gene Namezinc finger protein 324
SynonymsD430030K24Rik, ZF5128
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12965838-12974236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12968883 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 58 (H58L)
Ref Sequence ENSEMBL: ENSMUSP00000041944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000124387] [ENSMUST00000128293] [ENSMUST00000210619]
Predicted Effect probably damaging
Transcript: ENSMUST00000038701
AA Change: H58L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500
AA Change: H58L

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect possibly damaging
Transcript: ENSMUST00000128293
AA Change: H58L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500
AA Change: H58L

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210619
AA Change: H58L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Zfp324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Zfp324 APN 7 12969435 missense probably benign 0.02
IGL01943:Zfp324 APN 7 12968786 splice site probably benign
IGL02668:Zfp324 APN 7 12970846 missense probably damaging 1.00
R0883:Zfp324 UTSW 7 12971024 missense probably damaging 1.00
R0931:Zfp324 UTSW 7 12966258 missense probably benign 0.05
R1164:Zfp324 UTSW 7 12971624 missense probably benign 0.02
R1587:Zfp324 UTSW 7 12970643 missense possibly damaging 0.63
R1837:Zfp324 UTSW 7 12970229 missense probably benign 0.15
R1982:Zfp324 UTSW 7 12971218 missense probably damaging 1.00
R2333:Zfp324 UTSW 7 12971245 missense possibly damaging 0.93
R3155:Zfp324 UTSW 7 12968890 missense probably damaging 1.00
R4050:Zfp324 UTSW 7 12970867 missense probably damaging 1.00
R4784:Zfp324 UTSW 7 12971306 missense probably damaging 1.00
R4992:Zfp324 UTSW 7 12969373 missense probably benign 0.02
R5970:Zfp324 UTSW 7 12969366 missense probably benign 0.28
R6767:Zfp324 UTSW 7 12970600 missense probably null 0.13
R7007:Zfp324 UTSW 7 12971215 missense probably damaging 1.00
R7152:Zfp324 UTSW 7 12966271 missense probably benign 0.07
R7233:Zfp324 UTSW 7 12970597 nonsense probably null
X0062:Zfp324 UTSW 7 12971389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCAGTCTACAGGGAAGG -3'
(R):5'- GACTATATGTGTCCAGGGCAC -3'

Sequencing Primer
(F):5'- TCTACAGGGAAGGAAGATAAATGTC -3'
(R):5'- TCCTCTCACATCCCTATAGATAGAGG -3'
Posted On2019-06-26