Incidental Mutation 'R7164:U2af1l4'
ID557800
Institutional Source Beutler Lab
Gene Symbol U2af1l4
Ensembl Gene ENSMUSG00000078765
Gene NameU2 small nuclear RNA auxiliary factor 1-like 4
Synonymsauxiliary factor 26, U2af26
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30563301-30565365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30565119 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 103 (S103P)
Ref Sequence ENSEMBL: ENSMUSP00000146344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000043273] [ENSMUST00000043850] [ENSMUST00000043898] [ENSMUST00000108154] [ENSMUST00000108161] [ENSMUST00000163276] [ENSMUST00000163330] [ENSMUST00000163464] [ENSMUST00000163482] [ENSMUST00000163654] [ENSMUST00000163848] [ENSMUST00000164365] [ENSMUST00000166257] [ENSMUST00000166510] [ENSMUST00000166960] [ENSMUST00000167042] [ENSMUST00000167202] [ENSMUST00000167361] [ENSMUST00000167501] [ENSMUST00000168229] [ENSMUST00000168333] [ENSMUST00000168555] [ENSMUST00000168931] [ENSMUST00000171850] [ENSMUST00000171912] [ENSMUST00000172251] [ENSMUST00000207031] [ENSMUST00000207747] [ENSMUST00000207797] [ENSMUST00000208628]
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect silent
Transcript: ENSMUST00000043273
SMART Domains Protein: ENSMUSP00000039406
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043850
SMART Domains Protein: ENSMUSP00000042312
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043898
SMART Domains Protein: ENSMUSP00000044682
Gene: ENSMUSG00000036835

DomainStartEndE-ValueType
Pfam:PEN-2 7 99 2.9e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108161
SMART Domains Protein: ENSMUSP00000103796
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 8.8e-10 PFAM
SCOP:d1jmta_ 43 115 2e-17 SMART
PDB:1JMT|A 43 116 3e-40 PDB
Blast:RRM 45 116 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163276
Predicted Effect silent
Transcript: ENSMUST00000163330
SMART Domains Protein: ENSMUSP00000129385
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
RRM 39 116 5.99e-4 SMART
Pfam:zf-CCCH 122 148 4.9e-8 PFAM
low complexity region 160 192 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000163464
SMART Domains Protein: ENSMUSP00000125959
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 171 3.95e1 SMART
low complexity region 183 215 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000163482
SMART Domains Protein: ENSMUSP00000130649
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000163654
SMART Domains Protein: ENSMUSP00000131048
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 1.3e-9 PFAM
RRM 66 143 5.99e-4 SMART
low complexity region 167 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163848
Predicted Effect probably benign
Transcript: ENSMUST00000164365
Predicted Effect probably benign
Transcript: ENSMUST00000165722
SMART Domains Protein: ENSMUSP00000125790
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 1 26 4.7e-10 PFAM
PDB:1JMT|A 30 51 2e-6 PDB
SCOP:d1jmta_ 30 51 5e-3 SMART
Blast:RRM 32 53 7e-8 BLAST
Predicted Effect silent
Transcript: ENSMUST00000166257
SMART Domains Protein: ENSMUSP00000125838
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 33 104 2.35e-2 SMART
ZnF_C3H1 110 136 2.49e-1 SMART
low complexity region 148 180 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000166510
SMART Domains Protein: ENSMUSP00000132316
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 45 133 2.51e-6 SMART
ZnF_C3H1 139 165 2.49e-1 SMART
low complexity region 177 209 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000166960
Predicted Effect silent
Transcript: ENSMUST00000167042
SMART Domains Protein: ENSMUSP00000128886
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167202
AA Change: S103P

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect silent
Transcript: ENSMUST00000167361
Predicted Effect probably benign
Transcript: ENSMUST00000167501
Predicted Effect probably benign
Transcript: ENSMUST00000168229
Predicted Effect probably benign
Transcript: ENSMUST00000168333
SMART Domains Protein: ENSMUSP00000128950
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 4.8e-10 PFAM
PDB:1JMT|A 43 94 5e-21 PDB
SCOP:d1jmta_ 43 94 2e-9 SMART
Blast:RRM 45 94 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168555
Predicted Effect probably benign
Transcript: ENSMUST00000168931
SMART Domains Protein: ENSMUSP00000129697
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
RRM 44 119 4.14e-2 SMART
Predicted Effect silent
Transcript: ENSMUST00000171850
SMART Domains Protein: ENSMUSP00000131781
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
PDB:1JMT|A 43 113 1e-16 PDB
SCOP:d1jmta_ 43 113 1e-9 SMART
Blast:RRM 45 110 3e-17 BLAST
ZnF_C3H1 116 142 2.49e-1 SMART
low complexity region 154 186 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000171912
SMART Domains Protein: ENSMUSP00000130983
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172251
SMART Domains Protein: ENSMUSP00000132400
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
low complexity region 267 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207031
Predicted Effect probably benign
Transcript: ENSMUST00000207747
Predicted Effect probably benign
Transcript: ENSMUST00000207797
Predicted Effect probably benign
Transcript: ENSMUST00000208628
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display abnormal circadian rhythms in response to changing external cues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in U2af1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4738:U2af1l4 UTSW 7 30563348 intron probably benign
R5262:U2af1l4 UTSW 7 30564213 missense probably benign 0.05
R6164:U2af1l4 UTSW 7 30564582 missense probably damaging 0.99
R7429:U2af1l4 UTSW 7 30563390 missense probably benign 0.25
R7569:U2af1l4 UTSW 7 30563557 missense probably damaging 0.99
Z1176:U2af1l4 UTSW 7 30564281 missense probably benign 0.00
Z1177:U2af1l4 UTSW 7 30565140 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGTCCCAAACAGTGTAAACC -3'
(R):5'- CCTTTATTGGAGGAGGGACAGG -3'

Sequencing Primer
(F):5'- GTCCCAAACAGTGTAAACCCCATATC -3'
(R):5'- CGAACAGATTATATTATGAAGCTCCG -3'
Posted On2019-06-26