Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Vmn2r75'

557803

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r75

Ensembl Gene

ENSMUSG00000090436

Gene Name

vomeronasal 2, receptor 75

Synonyms

EG546981

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86148042-86171724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 86165384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 300 (D300E)

Ref Sequence

ENSEMBL: ENSMUSP00000126973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167830]

AlphaFold

G5E8Z7

Predicted Effect

probably damaging
Transcript: ENSMUST00000167830
AA Change: D300E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: D300E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	80	466	2.8e-31	PFAM
Pfam:NCD3G	510	562	4.6e-20	PFAM
Pfam:7tm_3	593	829	7.7e-51	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Vmn2r75

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Vmn2r75	APN	7	86148032	unclassified	probably benign
IGL01287:Vmn2r75	APN	7	86148593	missense	probably damaging	0.97
IGL01318:Vmn2r75	APN	7	86165566	missense	probably benign	0.06
IGL01331:Vmn2r75	APN	7	86171662	nonsense	probably null
IGL01406:Vmn2r75	APN	7	86163292	splice site	probably benign
IGL01615:Vmn2r75	APN	7	86148473	missense	probably benign	0.03
IGL01657:Vmn2r75	APN	7	86164247	missense	probably damaging	1.00
IGL02237:Vmn2r75	APN	7	86165578	missense	possibly damaging	0.88
IGL02275:Vmn2r75	APN	7	86165140	missense	probably benign	0.04
IGL02307:Vmn2r75	APN	7	86165766	missense	probably benign	0.00
IGL03136:Vmn2r75	APN	7	86148703	missense	possibly damaging	0.89
IGL03160:Vmn2r75	APN	7	86148436	missense	probably damaging	1.00
IGL03244:Vmn2r75	APN	7	86171725	unclassified	probably benign
PIT4449001:Vmn2r75	UTSW	7	86165583	missense	probably damaging	1.00
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0083:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0108:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0276:Vmn2r75	UTSW	7	86148307	missense	probably benign	0.01
R0320:Vmn2r75	UTSW	7	86165080	missense	probably benign	0.36
R0471:Vmn2r75	UTSW	7	86165513	missense	probably benign	0.01
R0562:Vmn2r75	UTSW	7	86148241	nonsense	probably null
R0631:Vmn2r75	UTSW	7	86163270	missense	probably null	1.00
R0661:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0811:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0812:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0891:Vmn2r75	UTSW	7	86164268	missense	possibly damaging	0.81
R1340:Vmn2r75	UTSW	7	86148590	missense	probably damaging	0.98
R1501:Vmn2r75	UTSW	7	86165642	missense	possibly damaging	0.85
R1760:Vmn2r75	UTSW	7	86148811	missense	probably damaging	1.00
R1970:Vmn2r75	UTSW	7	86148262	missense	probably damaging	1.00
R2060:Vmn2r75	UTSW	7	86165164	missense	probably benign	0.00
R2292:Vmn2r75	UTSW	7	86148936	missense	probably damaging	1.00
R3688:Vmn2r75	UTSW	7	86148421	missense	probably damaging	0.99
R3892:Vmn2r75	UTSW	7	86164286	missense	probably null	1.00
R4532:Vmn2r75	UTSW	7	86148141	nonsense	probably null
R4583:Vmn2r75	UTSW	7	86164082	missense	possibly damaging	0.81
R4592:Vmn2r75	UTSW	7	86166286	missense	probably benign	0.00
R4792:Vmn2r75	UTSW	7	86163170	missense	possibly damaging	0.46
R4859:Vmn2r75	UTSW	7	86148403	missense	probably benign	0.35
R4896:Vmn2r75	UTSW	7	86171579	missense	probably benign	0.01
R4943:Vmn2r75	UTSW	7	86165497	missense	probably damaging	1.00
R4992:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably null
R5048:Vmn2r75	UTSW	7	86165527	missense	possibly damaging	0.66
R5063:Vmn2r75	UTSW	7	86164164	missense	probably benign
R5156:Vmn2r75	UTSW	7	86164228	missense	possibly damaging	0.51
R5243:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R5277:Vmn2r75	UTSW	7	86166292	missense	probably benign
R5574:Vmn2r75	UTSW	7	86166302	missense	probably benign	0.22
R5622:Vmn2r75	UTSW	7	86148494	missense	probably benign	0.15
R5680:Vmn2r75	UTSW	7	86171571	missense	probably benign	0.10
R5884:Vmn2r75	UTSW	7	86165370	missense	probably benign
R6021:Vmn2r75	UTSW	7	86171612	missense	probably benign	0.01
R6217:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably benign
R6242:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R6299:Vmn2r75	UTSW	7	86165274	missense	probably benign	0.12
R6441:Vmn2r75	UTSW	7	86171576	missense	probably damaging	0.99
R6495:Vmn2r75	UTSW	7	86164079	missense	probably benign	0.00
R6553:Vmn2r75	UTSW	7	86164245	missense	probably benign	0.28
R6670:Vmn2r75	UTSW	7	86148436	missense	probably damaging	1.00
R7078:Vmn2r75	UTSW	7	86166360	missense	probably damaging	1.00
R8411:Vmn2r75	UTSW	7	86148514	missense	probably damaging	1.00
R8507:Vmn2r75	UTSW	7	86148477	nonsense	probably null
R8559:Vmn2r75	UTSW	7	86166272	missense	possibly damaging	0.65
R8677:Vmn2r75	UTSW	7	86165202	missense	possibly damaging	0.86
R8708:Vmn2r75	UTSW	7	86163268	missense	probably damaging	0.99
R8778:Vmn2r75	UTSW	7	86164289	missense	probably benign	0.40
R8968:Vmn2r75	UTSW	7	86171557	nonsense	probably null
R9145:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R9316:Vmn2r75	UTSW	7	86148105	missense	possibly damaging	0.63
R9363:Vmn2r75	UTSW	7	86166215	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTACAATTAGACGGTGGCAAAGAAC -3'
(R):5'- CACATTGTCTGTTTATCAGTTGCG -3'

Sequencing Primer
(F):5'- GGCAAAGAACATGTAAAATATGTCC -3'
(R):5'- TTATCCAAACTGAGAAGTTCATGGCC -3'

Posted On

2019-06-26