Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Mast1'

557806

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84935304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 63 (D63G)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109741
AA Change: D63G

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: D63G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119820
AA Change: D63G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: D63G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	84912150	missense	probably benign	0.18
R9526:Mast1	UTSW	8	84921176	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	84930845	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	84924031	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CATTGAGGCCTTTCCACTGG -3'
(R):5'- AAAGTCGGAGCCCTCTTAGAG -3'

Sequencing Primer
(F):5'- TGGTCCCCAGAGGCTACTC -3'
(R):5'- CCAAGGTGAGTTCAGTGACTC -3'

Posted On

2019-06-26