Incidental Mutation 'R7164:Olfr919'
ID 557808
Institutional Source Beutler Lab
Gene Symbol Olfr919
Ensembl Gene ENSMUSG00000056961
Gene Name olfactory receptor 919
Synonyms MOR171-23, GA_x6K02T2PVTD-32400678-32399743
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7164 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38696804-38703673 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38698219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 49 (I49T)
Ref Sequence ENSEMBL: ENSMUSP00000150303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071425] [ENSMUST00000215612] [ENSMUST00000217508]
AlphaFold Q8VF78
Predicted Effect possibly damaging
Transcript: ENSMUST00000071425
AA Change: I53T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071372
Gene: ENSMUSG00000056961
AA Change: I53T

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 9.8e-50 PFAM
Pfam:7tm_1 45 294 9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215612
AA Change: I49T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217508
AA Change: I49T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Olfr919
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr919 APN 9 38697905 missense probably benign 0.00
IGL02515:Olfr919 APN 9 38697791 missense probably benign 0.39
IGL02745:Olfr919 APN 9 38698198 missense probably damaging 0.99
H8562:Olfr919 UTSW 9 38697910 missense probably damaging 1.00
R1960:Olfr919 UTSW 9 38698204 missense probably benign 0.28
R1973:Olfr919 UTSW 9 38697868 missense probably damaging 0.96
R3119:Olfr919 UTSW 9 38697659 nonsense probably null
R4543:Olfr919 UTSW 9 38697545 missense possibly damaging 0.93
R4752:Olfr919 UTSW 9 38697970 missense probably damaging 0.99
R5474:Olfr919 UTSW 9 38698313 missense possibly damaging 0.69
R5532:Olfr919 UTSW 9 38697647 missense probably damaging 1.00
R5635:Olfr919 UTSW 9 38698159 missense possibly damaging 0.64
R5940:Olfr919 UTSW 9 38697711 nonsense probably null
R6820:Olfr919 UTSW 9 38697475 missense possibly damaging 0.88
R7337:Olfr919 UTSW 9 38697865 missense probably benign 0.12
R7806:Olfr919 UTSW 9 38698271 missense probably benign 0.39
R8287:Olfr919 UTSW 9 38698337 missense probably benign 0.06
R9120:Olfr919 UTSW 9 38697439 missense probably benign 0.01
Z1176:Olfr919 UTSW 9 38697928 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGCCAACATGTGACACTCAG -3'
(R):5'- TTGTCACACACCAAGAGCAG -3'

Sequencing Primer
(F):5'- TGTGACACTCAGATATAACAAAAGC -3'
(R):5'- CACCAAGAGCAGACAGATAAAC -3'
Posted On 2019-06-26