Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Itga3'

557816

Institutional Source

Beutler Lab

Gene Symbol

Itga3

Ensembl Gene

ENSMUSG00000001507

Gene Name

integrin alpha 3

Synonyms

VLA-3 alpha 3, alpha3-integrin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95044474-95076801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 95052479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 931 (V931M)

Ref Sequence

ENSEMBL: ENSMUSP00000113556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]

AlphaFold

Q62470

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001548
AA Change: V931M

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507
AA Change: V931M

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	7e-54	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107739
AA Change: V900M

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507
AA Change: V900M

Domain	Start	End	E-Value	Type
Int_alpha	20	79	1.05e2	SMART
Int_alpha	215	269	5.01e0	SMART
Int_alpha	273	330	3.07e-14	SMART
Int_alpha	335	388	4.17e-16	SMART
Int_alpha	396	452	7.57e1	SMART
low complexity region	490	503	N/A	INTRINSIC
low complexity region	775	789	N/A	INTRINSIC
transmembrane domain	963	985	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120375
AA Change: V931M

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507
AA Change: V931M

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	2e-53	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Itga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Itga3	APN	11	95065886	missense	probably damaging	1.00
IGL02020:Itga3	APN	11	95057390	missense	probably benign	0.02
IGL02413:Itga3	APN	11	95068771	missense	probably damaging	1.00
IGL02562:Itga3	APN	11	95068793	missense	probably benign	0.02
PIT4508001:Itga3	UTSW	11	95055893	missense	probably benign	0.20
R0485:Itga3	UTSW	11	95061970	missense	probably benign	0.05
R1548:Itga3	UTSW	11	95046919	critical splice donor site	probably null
R1677:Itga3	UTSW	11	95055759	missense	probably damaging	0.96
R2062:Itga3	UTSW	11	95054076	missense	possibly damaging	0.92
R2088:Itga3	UTSW	11	95052494	missense	probably benign	0.10
R2679:Itga3	UTSW	11	95068310	splice site	probably benign
R3697:Itga3	UTSW	11	95062725	missense	probably benign	0.00
R3839:Itga3	UTSW	11	95057269	critical splice donor site	probably null
R4210:Itga3	UTSW	11	95062623	missense	probably benign	0.00
R4533:Itga3	UTSW	11	95057293	missense	probably benign	0.15
R4849:Itga3	UTSW	11	95076271	missense	probably benign
R4863:Itga3	UTSW	11	95061967	missense	probably damaging	1.00
R4889:Itga3	UTSW	11	95068301	missense	probably benign	0.13
R5218:Itga3	UTSW	11	95062748	missense	probably benign	0.01
R6046:Itga3	UTSW	11	95062715	missense	probably benign	0.28
R6087:Itga3	UTSW	11	95052443	critical splice donor site	probably null
R6210:Itga3	UTSW	11	95068891	intron	probably benign
R6341:Itga3	UTSW	11	95055851	splice site	probably null
R6666:Itga3	UTSW	11	95065826	missense	probably benign	0.00
R6998:Itga3	UTSW	11	95051462	missense	probably benign	0.00
R7106:Itga3	UTSW	11	95055873	missense	probably benign	0.00
R7267:Itga3	UTSW	11	95076362	intron	probably benign
R7421:Itga3	UTSW	11	95068855	missense	probably benign	0.20
R7514:Itga3	UTSW	11	95065896	nonsense	probably null
R7533:Itga3	UTSW	11	95046518	missense	probably benign	0.45
R7736:Itga3	UTSW	11	95076203	missense	probably damaging	1.00
R8145:Itga3	UTSW	11	95052464	missense	probably damaging	1.00
R8303:Itga3	UTSW	11	95062640	missense	probably benign	0.42
R8459:Itga3	UTSW	11	95068807	missense	probably benign
R8464:Itga3	UTSW	11	95062740	missense	probably benign	0.28
R8951:Itga3	UTSW	11	95054085	missense	probably damaging	0.99
R8984:Itga3	UTSW	11	95062565	missense	probably damaging	1.00
R9262:Itga3	UTSW	11	95065799	missense	probably benign	0.09
R9695:Itga3	UTSW	11	95055694	critical splice donor site	probably null
Z1177:Itga3	UTSW	11	95056774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGTCACAGTAACAGACACAC -3'
(R):5'- TCCGAGAGTCCATCTTGCATG -3'

Sequencing Primer
(F):5'- CAACTGTGCAGAACATGATACC -3'
(R):5'- ATGTCACTCCAGGCTGGGATG -3'

Posted On

2019-06-26