Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Pde4d'

557819

Institutional Source

Beutler Lab

Gene Symbol

Pde4d

Ensembl Gene

ENSMUSG00000021699

Gene Name

phosphodiesterase 4D, cAMP specific

Synonyms

dunce, Dpde3, 9630011N22Rik

MMRRC Submission

045331-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108449948-109953461 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109032688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 88 (D88G)

Ref Sequence

ENSEMBL: ENSMUSP00000113488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122041] [ENSMUST00000177907]

AlphaFold

Q01063

Predicted Effect

probably benign
Transcript: ENSMUST00000122041
AA Change: D88G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: D88G

Domain	Start	End	E-Value	Type
HDc	398	573	1.12e-2	SMART
low complexity region	721	736	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177907
AA Change: D88G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: D88G

Domain	Start	End	E-Value	Type
HDc	398	573	1.12e-2	SMART
low complexity region	721	736	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Pde4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Pde4d	APN	13	109936687	missense	possibly damaging	0.69
IGL00792:Pde4d	APN	13	109935395	missense	possibly damaging	0.85
IGL01014:Pde4d	APN	13	109949502	missense	probably damaging	1.00
IGL01660:Pde4d	APN	13	109938072	missense	probably damaging	1.00
IGL02233:Pde4d	APN	13	109740550	missense	probably damaging	1.00
IGL02405:Pde4d	APN	13	108860209	critical splice donor site	probably null
IGL02544:Pde4d	APN	13	109740523	missense	probably damaging	1.00
IGL02885:Pde4d	APN	13	109948261	missense	probably damaging	1.00
IGL03286:Pde4d	APN	13	109954506	unclassified	probably benign
IGL03406:Pde4d	APN	13	109954591	unclassified	probably benign
Heliosphere	UTSW	13	109116942	missense	probably benign
Stubbs	UTSW	13	109772722	intron	probably benign
IGL03055:Pde4d	UTSW	13	109935345	missense	probably damaging	1.00
R0020:Pde4d	UTSW	13	109954570	missense	possibly damaging	0.66
R0020:Pde4d	UTSW	13	109954570	missense	possibly damaging	0.66
R0054:Pde4d	UTSW	13	109740421	missense	probably benign	0.23
R0054:Pde4d	UTSW	13	109740421	missense	probably benign	0.23
R0357:Pde4d	UTSW	13	109951268	missense	possibly damaging	0.46
R0482:Pde4d	UTSW	13	109936710	missense	probably benign	0.00
R0689:Pde4d	UTSW	13	109740544	missense	possibly damaging	0.78
R0884:Pde4d	UTSW	13	109950940	missense	probably damaging	0.99
R1169:Pde4d	UTSW	13	109950928	splice site	probably null
R1225:Pde4d	UTSW	13	109950221	missense	probably benign	0.04
R1246:Pde4d	UTSW	13	109950973	missense	probably damaging	1.00
R1344:Pde4d	UTSW	13	109950387	nonsense	probably null
R1351:Pde4d	UTSW	13	109951275	missense	possibly damaging	0.46
R1371:Pde4d	UTSW	13	109117061	missense	probably benign	0.00
R1418:Pde4d	UTSW	13	109950387	nonsense	probably null
R2197:Pde4d	UTSW	13	109948390	missense	probably damaging	1.00
R2440:Pde4d	UTSW	13	109927197	intron	probably benign
R3114:Pde4d	UTSW	13	109948258	missense	probably damaging	1.00
R3115:Pde4d	UTSW	13	109948258	missense	probably damaging	1.00
R3722:Pde4d	UTSW	13	109951332	nonsense	probably null
R3742:Pde4d	UTSW	13	109740479	missense	probably benign	0.42
R3797:Pde4d	UTSW	13	109632897	missense	probably benign	0.29
R3983:Pde4d	UTSW	13	109740406	missense	probably benign	0.23
R4618:Pde4d	UTSW	13	109933877	missense	probably benign	0.13
R4768:Pde4d	UTSW	13	109933874	missense	probably damaging	1.00
R4795:Pde4d	UTSW	13	109938171	intron	probably benign
R4824:Pde4d	UTSW	13	109116866	missense	probably benign	0.00
R4942:Pde4d	UTSW	13	108860199	missense	probably benign	0.00
R4984:Pde4d	UTSW	13	109740464	missense	probably damaging	1.00
R5180:Pde4d	UTSW	13	109740473	missense	probably benign	0.13
R5267:Pde4d	UTSW	13	109260809	intron	probably benign
R5311:Pde4d	UTSW	13	109632864	missense	probably benign	0.02
R5311:Pde4d	UTSW	13	109632865	missense	probably benign
R5376:Pde4d	UTSW	13	109772644	missense	probably benign	0.00
R5551:Pde4d	UTSW	13	109948396	critical splice donor site	probably null
R5753:Pde4d	UTSW	13	109772722	intron	probably benign
R5754:Pde4d	UTSW	13	109938013	missense	probably damaging	0.98
R5838:Pde4d	UTSW	13	109740442	missense	probably damaging	0.99
R5864:Pde4d	UTSW	13	109938048	missense	probably benign	0.00
R6039:Pde4d	UTSW	13	109948342	missense	probably damaging	1.00
R6039:Pde4d	UTSW	13	109948342	missense	probably damaging	1.00
R6049:Pde4d	UTSW	13	109032585	nonsense	probably null
R6214:Pde4d	UTSW	13	109949433	missense	probably damaging	1.00
R6215:Pde4d	UTSW	13	109949433	missense	probably damaging	1.00
R6273:Pde4d	UTSW	13	109950221	missense	possibly damaging	0.94
R6431:Pde4d	UTSW	13	109601786	splice site	probably null
R6501:Pde4d	UTSW	13	109116942	missense	probably benign
R6534:Pde4d	UTSW	13	109632901	missense	probably benign	0.05
R6709:Pde4d	UTSW	13	109948279	missense	probably damaging	1.00
R6722:Pde4d	UTSW	13	109632898	nonsense	probably null
R7222:Pde4d	UTSW	13	109757579	missense	probably damaging	1.00
R7417:Pde4d	UTSW	13	109632788	splice site	probably null
R7489:Pde4d	UTSW	13	109116767	missense	unknown
R7563:Pde4d	UTSW	13	109951007	missense	probably benign	0.37
R7861:Pde4d	UTSW	13	109935324	missense	probably damaging	0.99
R8167:Pde4d	UTSW	13	109442321	missense	probably benign	0.00
R8197:Pde4d	UTSW	13	109948336	missense	probably damaging	1.00
R8469:Pde4d	UTSW	13	108860188	missense	probably benign
R8715:Pde4d	UTSW	13	109935342	missense	probably benign	0.29
R8926:Pde4d	UTSW	13	109938091	missense	probably benign	0.00
R9054:Pde4d	UTSW	13	109935390	missense	probably damaging	0.96
R9406:Pde4d	UTSW	13	109740530	missense	probably damaging	0.99
R9516:Pde4d	UTSW	13	109260662	missense
R9526:Pde4d	UTSW	13	109935381	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATGGAGCCCTATCTCGTACG -3'
(R):5'- GCAGTCACCCAGTACTTTTCAAC -3'

Sequencing Primer
(F):5'- CCCTATCTCGTACGGCGAC -3'
(R):5'- CAACACTCTCTTGGAAAATGGTTC -3'

Posted On

2019-06-26