Incidental Mutation 'R7164:Zfp707'
ID 557821
Institutional Source Beutler Lab
Gene Symbol Zfp707
Ensembl Gene ENSMUSG00000034429
Gene Name zinc finger protein 707
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7164 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 75969123-75975868 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75975118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 339 (E339G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109966] [ENSMUST00000109967] [ENSMUST00000182172] [ENSMUST00000183130] [ENSMUST00000229652]
AlphaFold D3Z445
Predicted Effect possibly damaging
Transcript: ENSMUST00000109966
AA Change: E333G

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105592
Gene: ENSMUSG00000034429
AA Change: E333G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
KRAB 39 99 2.42e-31 SMART
ZnF_C2H2 189 211 9.96e-1 SMART
ZnF_C2H2 217 239 9.08e-4 SMART
ZnF_C2H2 245 267 3.58e-2 SMART
ZnF_C2H2 273 295 1.04e-3 SMART
ZnF_C2H2 301 323 2.09e-3 SMART
ZnF_C2H2 329 351 9.58e-3 SMART
ZnF_C2H2 357 379 1.28e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109967
AA Change: E287G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105593
Gene: ENSMUSG00000034429
AA Change: E287G

DomainStartEndE-ValueType
KRAB 4 53 3.59e-16 SMART
ZnF_C2H2 143 165 9.96e-1 SMART
ZnF_C2H2 171 193 9.08e-4 SMART
ZnF_C2H2 199 221 3.58e-2 SMART
ZnF_C2H2 227 249 1.04e-3 SMART
ZnF_C2H2 255 277 2.09e-3 SMART
ZnF_C2H2 283 305 9.58e-3 SMART
ZnF_C2H2 311 333 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145100
SMART Domains Protein: ENSMUSP00000120565
Gene: ENSMUSG00000034429

DomainStartEndE-ValueType
KRAB 23 83 2.42e-31 SMART
ZnF_C2H2 173 195 9.96e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147641
AA Change: E339G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119705
Gene: ENSMUSG00000034429
AA Change: E339G

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
KRAB 46 106 2.42e-31 SMART
ZnF_C2H2 196 218 9.96e-1 SMART
ZnF_C2H2 224 246 9.08e-4 SMART
ZnF_C2H2 252 274 3.58e-2 SMART
ZnF_C2H2 280 302 1.04e-3 SMART
ZnF_C2H2 308 330 2.09e-3 SMART
ZnF_C2H2 336 358 9.58e-3 SMART
ZnF_C2H2 364 386 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182172
SMART Domains Protein: ENSMUSP00000138510
Gene: ENSMUSG00000098176

DomainStartEndE-ValueType
Pfam:DUF4515 67 146 9.4e-6 PFAM
low complexity region 180 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183130
SMART Domains Protein: ENSMUSP00000138115
Gene: ENSMUSG00000098176

DomainStartEndE-ValueType
Pfam:DUF4515 67 260 2.3e-25 PFAM
low complexity region 265 288 N/A INTRINSIC
low complexity region 433 444 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229652
AA Change: E266G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Other mutations in Zfp707
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Zfp707 APN 15 75975195 missense probably damaging 1.00
R0505:Zfp707 UTSW 15 75975256 missense probably damaging 1.00
R0638:Zfp707 UTSW 15 75975129 missense possibly damaging 0.80
R1389:Zfp707 UTSW 15 75974616 missense probably damaging 0.99
R4806:Zfp707 UTSW 15 75973151 nonsense probably null
R6810:Zfp707 UTSW 15 75974899 missense probably damaging 1.00
R6823:Zfp707 UTSW 15 75969723 unclassified probably benign
R7105:Zfp707 UTSW 15 75974746 missense
R7124:Zfp707 UTSW 15 75973549 nonsense probably null
R8549:Zfp707 UTSW 15 75974698 missense probably benign 0.15
R9124:Zfp707 UTSW 15 75973619 missense
Z1177:Zfp707 UTSW 15 75975114 missense
Predicted Primers PCR Primer
(F):5'- GAAAAGCCCTTCTGCTGTGAG -3'
(R):5'- CAGGACCTGCTACACTTCTC -3'

Sequencing Primer
(F):5'- TTCAGCTTGAAGGACCGC -3'
(R):5'- ACTTCTCCTCGCCCGTGAG -3'
Posted On 2019-06-26