Incidental Mutation 'R7164:Bcl6'
ID557823
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene NameB cell leukemia/lymphoma 6
SynonymsBcl5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23965052-23988852 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 23966226 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 675 (R675*)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
Predicted Effect probably null
Transcript: ENSMUST00000023151
AA Change: R675*
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: R675*

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23974891 missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23977569 missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23975038 splice site probably benign
IGL03271:Bcl6 APN 16 23970006 missense probably benign 0.00
Adriatic UTSW 16 23968133 missense probably damaging 0.99
Catanzaro UTSW 16 23966226 nonsense probably null
Density UTSW 16 23970048 missense possibly damaging 0.91
nouvelle UTSW 16 23969986 missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23966219 missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23972594 missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23968139 missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23966155 missense probably benign
R1134:Bcl6 UTSW 16 23968365 missense probably benign
R1317:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23972347 missense probably benign 0.02
R1393:Bcl6 UTSW 16 23977566 missense probably damaging 0.99
R1761:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23974930 missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23972632 nonsense probably null
R2293:Bcl6 UTSW 16 23977609 missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23968119 missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23977554 missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23968453 intron probably benign
R5015:Bcl6 UTSW 16 23974850 missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23972746 missense probably benign
R5185:Bcl6 UTSW 16 23972947 missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23969986 missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23973176 missense probably benign 0.01
R5659:Bcl6 UTSW 16 23968409 nonsense probably null
R5909:Bcl6 UTSW 16 23972806 missense probably benign
R6384:Bcl6 UTSW 16 23974865 missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23974861 missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23972614 missense possibly damaging 0.94
R7097:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7122:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23966226 nonsense probably null
R7154:Bcl6 UTSW 16 23966226 nonsense probably null
R7155:Bcl6 UTSW 16 23966226 nonsense probably null
R7156:Bcl6 UTSW 16 23966226 nonsense probably null
R7163:Bcl6 UTSW 16 23966226 nonsense probably null
R7434:Bcl6 UTSW 16 23970048 missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23971413 critical splice donor site probably null
R7914:Bcl6 UTSW 16 23970011 missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23968133 missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23972948 missense probably benign 0.39
Z1176:Bcl6 UTSW 16 23969958 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGTGTTACAGCATCCTTTGGG -3'
(R):5'- CAGTGTATACCTAACCTCCAGTGG -3'

Sequencing Primer
(F):5'- ACAGCATCCTTTGGGTAGATTC -3'
(R):5'- CCTCCAGTGGAAGCCAAGATTTG -3'
Posted On2019-06-26