Incidental Mutation 'R7164:Igsf5'
ID 557824
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Name immunoglobulin superfamily, member 5
Synonyms Igsf5, Jam4, 2010003D20Rik
MMRRC Submission 045331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7164 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 96162868-96223321 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96174048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 26 (Q26L)
Ref Sequence ENSEMBL: ENSMUSP00000109425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113795]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000000163
AA Change: Q26L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159
AA Change: Q26L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081093
AA Change: Q26L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159
AA Change: Q26L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113794
AA Change: Q26L

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159
AA Change: Q26L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113795
AA Change: Q26L
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159
AA Change: Q26L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 G A 13: 12,293,847 (GRCm39) H558Y probably damaging Het
Ajm1 T A 2: 25,468,579 (GRCm39) H444L possibly damaging Het
Akap9 G C 5: 4,110,364 (GRCm39) E3022D probably damaging Het
Anapc2 C T 2: 25,175,011 (GRCm39) R710C probably damaging Het
Bcl6 G A 16: 23,784,976 (GRCm39) R675* probably null Het
Carmil3 A G 14: 55,738,739 (GRCm39) E844G probably damaging Het
Cdk17 T G 10: 93,068,343 (GRCm39) S367A probably benign Het
Cfap206 T A 4: 34,719,656 (GRCm39) M253L probably benign Het
Chd3 T G 11: 69,253,132 (GRCm39) K228Q probably damaging Het
Cit T A 5: 116,123,846 (GRCm39) I1503N possibly damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Czib C A 4: 107,752,087 (GRCm39) D155E not run Het
Degs1 A G 1: 182,106,690 (GRCm39) S226P probably damaging Het
Espl1 T C 15: 102,221,638 (GRCm39) W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 (GRCm39) P275L probably benign Het
Flnb A G 14: 7,915,944 (GRCm38) probably null Het
Gnptab T A 10: 88,269,932 (GRCm39) Y878* probably null Het
Gpr89 A T 3: 96,778,714 (GRCm39) M453K probably benign Het
Inpp5e T A 2: 26,297,995 (GRCm39) D202V possibly damaging Het
Itga3 C T 11: 94,943,305 (GRCm39) V931M possibly damaging Het
Kcnab3 T C 11: 69,222,184 (GRCm39) probably null Het
Klk4 T C 7: 43,531,122 (GRCm39) I17T possibly damaging Het
Lrrc73 T C 17: 46,567,169 (GRCm39) L206P probably damaging Het
Manba A T 3: 135,248,149 (GRCm39) N346I probably damaging Het
Map4k4 T C 1: 40,013,132 (GRCm39) Y76H possibly damaging Het
Map4k5 T C 12: 69,877,210 (GRCm39) T312A probably benign Het
Masp2 A G 4: 148,694,572 (GRCm39) probably null Het
Mast1 T C 8: 85,661,933 (GRCm39) D63G possibly damaging Het
Mtf2 T A 5: 108,241,235 (GRCm39) S254T possibly damaging Het
Myo16 A T 8: 10,619,585 (GRCm39) T1379S unknown Het
Myo5a A G 9: 75,087,435 (GRCm39) E1097G probably benign Het
Nat1 T C 8: 67,944,329 (GRCm39) V238A possibly damaging Het
Nhlrc2 A G 19: 56,580,931 (GRCm39) D493G probably damaging Het
Or10ak9 C T 4: 118,726,922 (GRCm39) P315S probably benign Het
Or1j21 T C 2: 36,683,709 (GRCm39) S154P probably benign Het
Or5ae2 A G 7: 84,506,251 (GRCm39) I227V possibly damaging Het
Or5b108 A T 19: 13,168,270 (GRCm39) M80L probably benign Het
Or5d20-ps1 T C 2: 87,932,176 (GRCm39) K52E probably damaging Het
Or8g51 A G 9: 38,609,515 (GRCm39) I49T possibly damaging Het
Pcsk5 C T 19: 17,429,349 (GRCm39) C1543Y probably damaging Het
Pde4d A G 13: 109,169,222 (GRCm39) D88G probably benign Het
Pld5 A T 1: 176,041,187 (GRCm39) M1K probably null Het
Prmt6 A G 3: 110,157,680 (GRCm39) M203T probably benign Het
Prr14l A T 5: 32,986,510 (GRCm39) V995D probably damaging Het
Psg18 T C 7: 18,084,862 (GRCm39) E199G possibly damaging Het
Pth1r A G 9: 110,552,815 (GRCm39) I439T possibly damaging Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Slc44a1 T C 4: 53,528,711 (GRCm39) S154P probably benign Het
Slco1c1 T A 6: 141,487,855 (GRCm39) Y192* probably null Het
Spag16 A G 1: 70,764,025 (GRCm39) H615R possibly damaging Het
Spata31h1 G A 10: 82,122,063 (GRCm39) T3649I probably damaging Het
Tas2r114 G A 6: 131,666,728 (GRCm39) A100V possibly damaging Het
U2af1l4 T C 7: 30,264,544 (GRCm39) S103P probably benign Het
Usp10 T C 8: 120,668,847 (GRCm39) S383P probably damaging Het
Vmn2r113 A G 17: 23,167,137 (GRCm39) R505G probably benign Het
Vmn2r75 A C 7: 85,814,592 (GRCm39) D300E probably damaging Het
Zfp318 T A 17: 46,708,232 (GRCm39) probably null Het
Zfp318 T C 17: 46,716,865 (GRCm39) V999A probably damaging Het
Zfp324 A T 7: 12,702,810 (GRCm39) H58L probably damaging Het
Zfp707 A G 15: 75,846,967 (GRCm39) E339G possibly damaging Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96,192,220 (GRCm39) missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96,174,353 (GRCm39) splice site probably benign
IGL02576:Igsf5 APN 16 96,187,781 (GRCm39) missense probably benign 0.23
IGL02721:Igsf5 APN 16 96,192,222 (GRCm39) missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96,326,632 (GRCm39) missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96,174,023 (GRCm39) splice site probably benign
R1858:Igsf5 UTSW 16 96,187,829 (GRCm39) splice site probably null
R1961:Igsf5 UTSW 16 96,179,551 (GRCm39) missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96,165,247 (GRCm39) missense probably benign 0.01
R4491:Igsf5 UTSW 16 96,165,281 (GRCm39) missense probably benign 0.02
R5123:Igsf5 UTSW 16 96,174,279 (GRCm39) missense probably damaging 1.00
R5262:Igsf5 UTSW 16 96,192,237 (GRCm39) nonsense probably null
R5384:Igsf5 UTSW 16 96,192,226 (GRCm39) missense probably benign 0.21
R5558:Igsf5 UTSW 16 96,187,731 (GRCm39) missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96,174,072 (GRCm39) missense probably benign 0.07
R5957:Igsf5 UTSW 16 96,165,249 (GRCm39) missense probably benign 0.10
R6199:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96,197,648 (GRCm39) missense possibly damaging 0.93
R7197:Igsf5 UTSW 16 96,204,546 (GRCm39) missense probably damaging 1.00
R8213:Igsf5 UTSW 16 96,174,188 (GRCm39) missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8453:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8823:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R9798:Igsf5 UTSW 16 96,174,075 (GRCm39) missense probably damaging 1.00
Z1176:Igsf5 UTSW 16 96,192,223 (GRCm39) missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96,179,533 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTGGCCATGTGTCTACCAG -3'
(R):5'- CGAGATGAAGCTGTCAGTGCTG -3'

Sequencing Primer
(F):5'- TGGCCATGTGTCTACCAGAAGTC -3'
(R):5'- AAGCTGTCAGTGCTGTTGTAAC -3'
Posted On 2019-06-26