Incidental Mutation 'R7164:Lrrc73'
ID557826
Institutional Source Beutler Lab
Gene Symbol Lrrc73
Ensembl Gene ENSMUSG00000071073
Gene Nameleucine rich repeat containing 73
SynonymsGm88, LOC224813
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46254165-46257316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46256243 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 206 (L206P)
Ref Sequence ENSEMBL: ENSMUSP00000092896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012440] [ENSMUST00000095262] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000164342] [ENSMUST00000180283] [ENSMUST00000225080] [ENSMUST00000225413]
Predicted Effect probably benign
Transcript: ENSMUST00000012440
SMART Domains Protein: ENSMUSP00000012440
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095262
AA Change: L206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073
AA Change: L206P

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164342
SMART Domains Protein: ENSMUSP00000130710
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 262 447 1.5e-59 PFAM
Pfam:Pilt 442 538 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180283
SMART Domains Protein: ENSMUSP00000137220
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225080
Predicted Effect probably benign
Transcript: ENSMUST00000225413
Meta Mutation Damage Score 0.8607 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Lrrc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Lrrc73 APN 17 46255731 missense possibly damaging 0.95
IGL02499:Lrrc73 APN 17 46256989 unclassified probably benign
R1643:Lrrc73 UTSW 17 46255340 critical splice donor site probably null
R1748:Lrrc73 UTSW 17 46255695 missense probably damaging 1.00
R7238:Lrrc73 UTSW 17 46254562 missense probably damaging 1.00
R7432:Lrrc73 UTSW 17 46255783 critical splice donor site probably null
R8859:Lrrc73 UTSW 17 46254529 missense probably benign 0.11
R9035:Lrrc73 UTSW 17 46254367 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAATCTGGGTCTGACTTGC -3'
(R):5'- GTAATTTTCTACCATGTCCAGCAGG -3'

Sequencing Primer
(F):5'- AGAATCTGGGTCTGACTTGCTTCATC -3'
(R):5'- TGCTCTTCCTAAGGACCAGAG -3'
Posted On2019-06-26