Mutagenetix > Incidental Mutations

Incidental Mutation 'R7164:Zfp318'

557827

Institutional Source

Beutler Lab

Gene Symbol

Zfp318

Ensembl Gene

ENSMUSG00000015597

Gene Name

zinc finger protein 318

Synonyms

2610034E08Rik, D530032D06Rik, TZF

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46383731-46420920 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 46397306 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]

AlphaFold

Q99PP2

Predicted Effect

probably null
Transcript: ENSMUST00000113481

SMART Domains

Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	30	127	N/A	INTRINSIC
low complexity region	150	169	N/A	INTRINSIC
low complexity region	208	221	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
coiled coil region	348	376	N/A	INTRINSIC
SCOP:d1eq1a_	916	995	2e-4	SMART
low complexity region	1018	1055	N/A	INTRINSIC
ZnF_U1	1085	1119	5.99e-7	SMART
ZnF_C2H2	1088	1112	4.5e1	SMART
ZnF_U1	1155	1189	2.1e-11	SMART
ZnF_C2H2	1158	1180	4.62e1	SMART
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1358	1371	N/A	INTRINSIC
low complexity region	1640	1651	N/A	INTRINSIC
Blast:HNHc	1660	1710	3e-17	BLAST
low complexity region	2001	2013	N/A	INTRINSIC
low complexity region	2110	2121	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000138127

SMART Domains

Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	30	127	N/A	INTRINSIC
low complexity region	150	169	N/A	INTRINSIC
low complexity region	208	221	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
coiled coil region	348	376	N/A	INTRINSIC
Blast:HOLI	854	1114	8e-19	BLAST
SCOP:d1eq1a_	916	995	6e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152472

SMART Domains

Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

Domain	Start	End	E-Value	Type
coiled coil region	3	30	N/A	INTRINSIC

Meta Mutation Damage Score

0.9596

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Zfp318

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Zfp318	APN	17	46412472	missense	probably benign	0.01
IGL00978:Zfp318	APN	17	46413726	missense	possibly damaging	0.64
IGL01016:Zfp318	APN	17	46400077	missense	probably damaging	1.00
IGL01310:Zfp318	APN	17	46413227	missense	possibly damaging	0.81
IGL01453:Zfp318	APN	17	46409016	splice site	probably null
IGL01887:Zfp318	APN	17	46399168	missense	probably benign	0.07
IGL02025:Zfp318	APN	17	46396810	nonsense	probably null
IGL02026:Zfp318	APN	17	46396810	nonsense	probably null
IGL02070:Zfp318	APN	17	46396718	missense	probably damaging	1.00
IGL02182:Zfp318	APN	17	46396810	nonsense	probably null
IGL02187:Zfp318	APN	17	46396810	nonsense	probably null
IGL02188:Zfp318	APN	17	46396810	nonsense	probably null
IGL02189:Zfp318	APN	17	46396810	nonsense	probably null
IGL02190:Zfp318	APN	17	46396810	nonsense	probably null
IGL02191:Zfp318	APN	17	46396810	nonsense	probably null
IGL02192:Zfp318	APN	17	46396810	nonsense	probably null
IGL02203:Zfp318	APN	17	46396810	nonsense	probably null
IGL02224:Zfp318	APN	17	46396810	nonsense	probably null
IGL02230:Zfp318	APN	17	46396810	nonsense	probably null
IGL02231:Zfp318	APN	17	46396810	nonsense	probably null
IGL02232:Zfp318	APN	17	46396810	nonsense	probably null
IGL02233:Zfp318	APN	17	46396810	nonsense	probably null
IGL02234:Zfp318	APN	17	46396810	nonsense	probably null
IGL02412:Zfp318	APN	17	46409117	nonsense	probably null
IGL02792:Zfp318	APN	17	46409178	missense	probably damaging	1.00
IGL02826:Zfp318	APN	17	46398754	missense	probably damaging	1.00
Wonton	UTSW	17	46409692	missense	possibly damaging	0.89
I0000:Zfp318	UTSW	17	46399559	missense	probably damaging	1.00
R0206:Zfp318	UTSW	17	46399019	missense	probably benign	0.07
R0240:Zfp318	UTSW	17	46396813	missense	probably benign	0.00
R0240:Zfp318	UTSW	17	46396813	missense	probably benign	0.00
R0281:Zfp318	UTSW	17	46412614	missense	probably benign	0.05
R0350:Zfp318	UTSW	17	46413198	missense	probably benign	0.00
R0383:Zfp318	UTSW	17	46413296	missense	probably damaging	0.99
R0453:Zfp318	UTSW	17	46396708	missense	probably damaging	0.96
R1014:Zfp318	UTSW	17	46412536	nonsense	probably null
R1166:Zfp318	UTSW	17	46409692	missense	possibly damaging	0.89
R1208:Zfp318	UTSW	17	46412520	unclassified	probably benign
R1208:Zfp318	UTSW	17	46412520	unclassified	probably benign
R1327:Zfp318	UTSW	17	46413263	missense	probably damaging	1.00
R1330:Zfp318	UTSW	17	46413758	missense	possibly damaging	0.90
R1737:Zfp318	UTSW	17	46399477	missense	probably benign	0.35
R1800:Zfp318	UTSW	17	46412054	missense	probably benign	0.00
R1846:Zfp318	UTSW	17	46413666	missense	probably benign	0.00
R1848:Zfp318	UTSW	17	46406055	missense	possibly damaging	0.92
R1861:Zfp318	UTSW	17	46411440	missense	possibly damaging	0.92
R1913:Zfp318	UTSW	17	46412524	unclassified	probably benign
R1913:Zfp318	UTSW	17	46412514	unclassified	probably benign
R2059:Zfp318	UTSW	17	46397024	missense	probably damaging	0.99
R2085:Zfp318	UTSW	17	46409664	splice site	probably null
R2122:Zfp318	UTSW	17	46413371	missense	probably benign	0.01
R2339:Zfp318	UTSW	17	46399463	missense	probably benign	0.01
R4526:Zfp318	UTSW	17	46412358	missense	probably benign	0.00
R4564:Zfp318	UTSW	17	46412815	missense	possibly damaging	0.77
R4689:Zfp318	UTSW	17	46399634	missense	probably damaging	0.99
R4795:Zfp318	UTSW	17	46412062	missense	probably benign	0.07
R5256:Zfp318	UTSW	17	46412069	missense	probably benign	0.19
R5317:Zfp318	UTSW	17	46412537	unclassified	probably benign
R5323:Zfp318	UTSW	17	46386736	missense	probably damaging	0.99
R5436:Zfp318	UTSW	17	46413049	missense	possibly damaging	0.95
R5485:Zfp318	UTSW	17	46412254	missense	possibly damaging	0.81
R5627:Zfp318	UTSW	17	46413136	missense	probably damaging	1.00
R5643:Zfp318	UTSW	17	46409244	intron	probably benign
R5782:Zfp318	UTSW	17	46412514	unclassified	probably benign
R5783:Zfp318	UTSW	17	46412514	unclassified	probably benign
R5820:Zfp318	UTSW	17	46412773	missense	probably benign
R5895:Zfp318	UTSW	17	46399033	missense	probably damaging	1.00
R6189:Zfp318	UTSW	17	46412514	unclassified	probably benign
R6385:Zfp318	UTSW	17	46411006	missense	probably damaging	1.00
R6428:Zfp318	UTSW	17	46399336	missense	probably damaging	1.00
R6471:Zfp318	UTSW	17	46399505	missense	probably benign	0.05
R6666:Zfp318	UTSW	17	46409214	missense	probably benign	0.01
R6812:Zfp318	UTSW	17	46412542	unclassified	probably benign
R6852:Zfp318	UTSW	17	46412533	unclassified	probably benign
R6852:Zfp318	UTSW	17	46412534	unclassified	probably benign
R6852:Zfp318	UTSW	17	46412538	unclassified	probably benign
R6854:Zfp318	UTSW	17	46412542	unclassified	probably benign
R6980:Zfp318	UTSW	17	46397212	missense	probably damaging	1.00
R6999:Zfp318	UTSW	17	46400043	missense	probably damaging	1.00
R7164:Zfp318	UTSW	17	46405939	missense	probably damaging	1.00
R7175:Zfp318	UTSW	17	46386848	missense	probably damaging	1.00
R7233:Zfp318	UTSW	17	46406052	missense	probably damaging	0.99
R7339:Zfp318	UTSW	17	46411247	missense	probably damaging	0.99
R7426:Zfp318	UTSW	17	46400069	missense	probably damaging	1.00
R7600:Zfp318	UTSW	17	46384284	missense	possibly damaging	0.86
R7608:Zfp318	UTSW	17	46400009	missense	probably damaging	0.96
R7779:Zfp318	UTSW	17	46399894	missense	probably benign	0.16
R8057:Zfp318	UTSW	17	46399766	missense	possibly damaging	0.72
R8273:Zfp318	UTSW	17	46412375	missense	probably damaging	1.00
R8274:Zfp318	UTSW	17	46412989	missense	probably benign
R8695:Zfp318	UTSW	17	46412650	missense	probably benign	0.01
R8822:Zfp318	UTSW	17	46412905	missense	probably benign	0.00
R8851:Zfp318	UTSW	17	46399835	missense	probably damaging	1.00
R8913:Zfp318	UTSW	17	46411773	missense	probably benign	0.07
R8953:Zfp318	UTSW	17	46420430	missense	probably benign	0.38
R9031:Zfp318	UTSW	17	46412507	missense	probably benign	0.15
X0026:Zfp318	UTSW	17	46410638	missense	possibly damaging	0.89
X0054:Zfp318	UTSW	17	46412609	missense	possibly damaging	0.79
X0065:Zfp318	UTSW	17	46410989	missense	probably benign	0.01
Z1176:Zfp318	UTSW	17	46405978	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCTTGAGTCAAGAGCTGGTG -3'
(R):5'- TCACATTCCAAGATTCCTATAGGGC -3'

Sequencing Primer
(F):5'- AGTCAAGAGCTGGTGGGTGTTG -3'
(R):5'- TCCAAGATTCCTATAGGGCTATTC -3'

Posted On

2019-06-26