Mutagenetix > Incidental Mutation

Incidental Mutation 'R7164:Zfp318'

557828

Institutional Source

Beutler Lab

Gene Symbol

Zfp318

Ensembl Gene

ENSMUSG00000015597

Gene Name

zinc finger protein 318

Synonyms

2610034E08Rik, D530032D06Rik, TZF

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46383731-46420920 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46405939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 999 (V999A)

Ref Sequence

ENSEMBL: ENSMUSP00000109109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]

AlphaFold

Q99PP2

Predicted Effect

probably damaging
Transcript: ENSMUST00000113481
AA Change: V999A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597
AA Change: V999A

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	30	127	N/A	INTRINSIC
low complexity region	150	169	N/A	INTRINSIC
low complexity region	208	221	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
coiled coil region	348	376	N/A	INTRINSIC
SCOP:d1eq1a_	916	995	2e-4	SMART
low complexity region	1018	1055	N/A	INTRINSIC
ZnF_U1	1085	1119	5.99e-7	SMART
ZnF_C2H2	1088	1112	4.5e1	SMART
ZnF_U1	1155	1189	2.1e-11	SMART
ZnF_C2H2	1158	1180	4.62e1	SMART
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1358	1371	N/A	INTRINSIC
low complexity region	1640	1651	N/A	INTRINSIC
Blast:HNHc	1660	1710	3e-17	BLAST
low complexity region	2001	2013	N/A	INTRINSIC
low complexity region	2110	2121	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138127
AA Change: V999A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597
AA Change: V999A

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	30	127	N/A	INTRINSIC
low complexity region	150	169	N/A	INTRINSIC
low complexity region	208	221	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
coiled coil region	348	376	N/A	INTRINSIC
Blast:HOLI	854	1114	8e-19	BLAST
SCOP:d1eq1a_	916	995	6e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152472

SMART Domains

Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

Domain	Start	End	E-Value	Type
coiled coil region	3	30	N/A	INTRINSIC

Meta Mutation Damage Score

0.1389

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Cfap206	T	A	4: 34,719,656	M253L	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Zfp318

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Zfp318	APN	17	46412472	missense	probably benign	0.01
IGL00978:Zfp318	APN	17	46413726	missense	possibly damaging	0.64
IGL01016:Zfp318	APN	17	46400077	missense	probably damaging	1.00
IGL01310:Zfp318	APN	17	46413227	missense	possibly damaging	0.81
IGL01453:Zfp318	APN	17	46409016	splice site	probably null
IGL01887:Zfp318	APN	17	46399168	missense	probably benign	0.07
IGL02025:Zfp318	APN	17	46396810	nonsense	probably null
IGL02026:Zfp318	APN	17	46396810	nonsense	probably null
IGL02070:Zfp318	APN	17	46396718	missense	probably damaging	1.00
IGL02182:Zfp318	APN	17	46396810	nonsense	probably null
IGL02187:Zfp318	APN	17	46396810	nonsense	probably null
IGL02188:Zfp318	APN	17	46396810	nonsense	probably null
IGL02189:Zfp318	APN	17	46396810	nonsense	probably null
IGL02190:Zfp318	APN	17	46396810	nonsense	probably null
IGL02191:Zfp318	APN	17	46396810	nonsense	probably null
IGL02192:Zfp318	APN	17	46396810	nonsense	probably null
IGL02203:Zfp318	APN	17	46396810	nonsense	probably null
IGL02224:Zfp318	APN	17	46396810	nonsense	probably null
IGL02230:Zfp318	APN	17	46396810	nonsense	probably null
IGL02231:Zfp318	APN	17	46396810	nonsense	probably null
IGL02232:Zfp318	APN	17	46396810	nonsense	probably null
IGL02233:Zfp318	APN	17	46396810	nonsense	probably null
IGL02234:Zfp318	APN	17	46396810	nonsense	probably null
IGL02412:Zfp318	APN	17	46409117	nonsense	probably null
IGL02792:Zfp318	APN	17	46409178	missense	probably damaging	1.00
IGL02826:Zfp318	APN	17	46398754	missense	probably damaging	1.00
Wonton	UTSW	17	46409692	missense	possibly damaging	0.89
I0000:Zfp318	UTSW	17	46399559	missense	probably damaging	1.00
R0206:Zfp318	UTSW	17	46399019	missense	probably benign	0.07
R0240:Zfp318	UTSW	17	46396813	missense	probably benign	0.00
R0240:Zfp318	UTSW	17	46396813	missense	probably benign	0.00
R0281:Zfp318	UTSW	17	46412614	missense	probably benign	0.05
R0350:Zfp318	UTSW	17	46413198	missense	probably benign	0.00
R0383:Zfp318	UTSW	17	46413296	missense	probably damaging	0.99
R0453:Zfp318	UTSW	17	46396708	missense	probably damaging	0.96
R1014:Zfp318	UTSW	17	46412536	nonsense	probably null
R1166:Zfp318	UTSW	17	46409692	missense	possibly damaging	0.89
R1208:Zfp318	UTSW	17	46412520	unclassified	probably benign
R1208:Zfp318	UTSW	17	46412520	unclassified	probably benign
R1327:Zfp318	UTSW	17	46413263	missense	probably damaging	1.00
R1330:Zfp318	UTSW	17	46413758	missense	possibly damaging	0.90
R1737:Zfp318	UTSW	17	46399477	missense	probably benign	0.35
R1800:Zfp318	UTSW	17	46412054	missense	probably benign	0.00
R1846:Zfp318	UTSW	17	46413666	missense	probably benign	0.00
R1848:Zfp318	UTSW	17	46406055	missense	possibly damaging	0.92
R1861:Zfp318	UTSW	17	46411440	missense	possibly damaging	0.92
R1913:Zfp318	UTSW	17	46412524	unclassified	probably benign
R1913:Zfp318	UTSW	17	46412514	unclassified	probably benign
R2059:Zfp318	UTSW	17	46397024	missense	probably damaging	0.99
R2085:Zfp318	UTSW	17	46409664	splice site	probably null
R2122:Zfp318	UTSW	17	46413371	missense	probably benign	0.01
R2339:Zfp318	UTSW	17	46399463	missense	probably benign	0.01
R4526:Zfp318	UTSW	17	46412358	missense	probably benign	0.00
R4564:Zfp318	UTSW	17	46412815	missense	possibly damaging	0.77
R4689:Zfp318	UTSW	17	46399634	missense	probably damaging	0.99
R4795:Zfp318	UTSW	17	46412062	missense	probably benign	0.07
R5256:Zfp318	UTSW	17	46412069	missense	probably benign	0.19
R5317:Zfp318	UTSW	17	46412537	unclassified	probably benign
R5323:Zfp318	UTSW	17	46386736	missense	probably damaging	0.99
R5436:Zfp318	UTSW	17	46413049	missense	possibly damaging	0.95
R5485:Zfp318	UTSW	17	46412254	missense	possibly damaging	0.81
R5627:Zfp318	UTSW	17	46413136	missense	probably damaging	1.00
R5643:Zfp318	UTSW	17	46409244	intron	probably benign
R5782:Zfp318	UTSW	17	46412514	unclassified	probably benign
R5783:Zfp318	UTSW	17	46412514	unclassified	probably benign
R5820:Zfp318	UTSW	17	46412773	missense	probably benign
R5895:Zfp318	UTSW	17	46399033	missense	probably damaging	1.00
R6189:Zfp318	UTSW	17	46412514	unclassified	probably benign
R6385:Zfp318	UTSW	17	46411006	missense	probably damaging	1.00
R6428:Zfp318	UTSW	17	46399336	missense	probably damaging	1.00
R6471:Zfp318	UTSW	17	46399505	missense	probably benign	0.05
R6666:Zfp318	UTSW	17	46409214	missense	probably benign	0.01
R6812:Zfp318	UTSW	17	46412542	unclassified	probably benign
R6852:Zfp318	UTSW	17	46412533	unclassified	probably benign
R6852:Zfp318	UTSW	17	46412534	unclassified	probably benign
R6852:Zfp318	UTSW	17	46412538	unclassified	probably benign
R6854:Zfp318	UTSW	17	46412542	unclassified	probably benign
R6980:Zfp318	UTSW	17	46397212	missense	probably damaging	1.00
R6999:Zfp318	UTSW	17	46400043	missense	probably damaging	1.00
R7164:Zfp318	UTSW	17	46397306	critical splice donor site	probably null
R7175:Zfp318	UTSW	17	46386848	missense	probably damaging	1.00
R7233:Zfp318	UTSW	17	46406052	missense	probably damaging	0.99
R7339:Zfp318	UTSW	17	46411247	missense	probably damaging	0.99
R7426:Zfp318	UTSW	17	46400069	missense	probably damaging	1.00
R7600:Zfp318	UTSW	17	46384284	missense	possibly damaging	0.86
R7608:Zfp318	UTSW	17	46400009	missense	probably damaging	0.96
R7779:Zfp318	UTSW	17	46399894	missense	probably benign	0.16
R8057:Zfp318	UTSW	17	46399766	missense	possibly damaging	0.72
R8273:Zfp318	UTSW	17	46412375	missense	probably damaging	1.00
R8274:Zfp318	UTSW	17	46412989	missense	probably benign
R8695:Zfp318	UTSW	17	46412650	missense	probably benign	0.01
R8822:Zfp318	UTSW	17	46412905	missense	probably benign	0.00
R8851:Zfp318	UTSW	17	46399835	missense	probably damaging	1.00
R8913:Zfp318	UTSW	17	46411773	missense	probably benign	0.07
R8953:Zfp318	UTSW	17	46420430	missense	probably benign	0.38
R9031:Zfp318	UTSW	17	46412507	missense	probably benign	0.15
R9327:Zfp318	UTSW	17	46410966	missense	probably damaging	1.00
R9329:Zfp318	UTSW	17	46411213	missense	probably damaging	1.00
R9352:Zfp318	UTSW	17	46410358	missense	probably damaging	1.00
R9633:Zfp318	UTSW	17	46399495	missense	probably damaging	0.99
R9662:Zfp318	UTSW	17	46413457	missense	probably damaging	1.00
R9728:Zfp318	UTSW	17	46396787	missense	probably benign	0.10
R9755:Zfp318	UTSW	17	46411129	missense	probably damaging	1.00
X0026:Zfp318	UTSW	17	46410638	missense	possibly damaging	0.89
X0054:Zfp318	UTSW	17	46412609	missense	possibly damaging	0.79
X0065:Zfp318	UTSW	17	46410989	missense	probably benign	0.01
Z1176:Zfp318	UTSW	17	46405978	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ATTTGACCATTCAGGGGAGATG -3'
(R):5'- TAGCTATGTGTGAACAGAGGAC -3'

Sequencing Primer
(F):5'- ACCATTCAGGGGAGATGTTGCG -3'
(R):5'- TCAGGCTTCTCTGTAGACTC -3'

Posted On

2019-06-26