Incidental Mutation 'R7165:Prim2'
ID557833
Institutional Source Beutler Lab
Gene Symbol Prim2
Ensembl Gene ENSMUSG00000026134
Gene NameDNA primase, p58 subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R7165 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location33453810-33669795 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 33628393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027312]
Predicted Effect probably null
Transcript: ENSMUST00000027312
SMART Domains Protein: ENSMUSP00000027312
Gene: ENSMUSG00000026134

DomainStartEndE-ValueType
Pfam:DNA_primase_lrg 182 448 6.2e-99 PFAM
low complexity region 482 503 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl C A 2: 128,123,108 A624E probably benign Het
Adnp A G 2: 168,182,367 S1003P probably benign Het
Akap8l T C 17: 32,338,412 D75G probably damaging Het
Ap4e1 A T 2: 127,063,318 T970S possibly damaging Het
Asb3 T A 11: 31,029,029 N106K probably damaging Het
Atp1a3 T C 7: 24,978,965 I988V probably benign Het
Camta1 A G 4: 151,084,700 L198S possibly damaging Het
Ccdc77 A G 6: 120,350,232 L84P probably damaging Het
Ccne1 C T 7: 38,099,301 A298T probably damaging Het
Cdc42bpb T A 12: 111,321,517 E532V probably damaging Het
Clasp2 G A 9: 113,786,399 probably null Het
Cntnap5b C A 1: 100,076,162 T289N possibly damaging Het
Dcun1d4 A G 5: 73,491,195 probably null Het
Dnah14 A G 1: 181,704,535 T2296A probably benign Het
Dnaja4 A T 9: 54,709,232 Q173L probably damaging Het
Dync2h1 G A 9: 7,050,479 A3190V probably benign Het
Frrs1 T A 3: 116,878,271 I6N probably benign Het
Fscn1 T C 5: 142,972,046 V477A probably benign Het
Fsip2 G A 2: 82,981,197 G2620E possibly damaging Het
Glp1r C T 17: 30,909,323 A92V probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm9573 A G 17: 35,621,978 S439P unknown Het
Gpr137b A T 13: 13,367,620 M204K probably damaging Het
Gstm1 A G 3: 108,016,377 V104A probably benign Het
Gtf2e1 A T 16: 37,535,866 N101K probably damaging Het
Igsf9b T C 9: 27,334,240 F1168L probably benign Het
Itpr2 A T 6: 146,294,091 V1629E probably damaging Het
Kat14 A G 2: 144,393,998 T428A probably benign Het
Kif21b T C 1: 136,149,448 Y403H probably damaging Het
Lpcat1 G C 13: 73,514,530 A533P probably benign Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Mboat1 A T 13: 30,224,415 Y187F probably damaging Het
Mkx T C 18: 7,002,525 N7S probably damaging Het
Mrps27 A T 13: 99,414,799 T357S possibly damaging Het
Naa35 A G 13: 59,586,183 D9G probably benign Het
Ncoa4 T A 14: 32,175,983 N253K probably damaging Het
Neb A G 2: 52,270,306 Y2232H probably damaging Het
Nlk G A 11: 78,590,967 Q223* probably null Het
Npas2 T A 1: 39,292,717 I71N possibly damaging Het
Nup107 T A 10: 117,773,362 Q364L probably damaging Het
Olfr146 T A 9: 39,023,270 probably benign Het
Otof C T 5: 30,375,620 G1593S probably damaging Het
Panx3 G T 9: 37,664,085 H160Q probably damaging Het
Pappa T A 4: 65,261,873 H990Q probably damaging Het
Pax4 G A 6: 28,446,137 P119L probably damaging Het
Pcdhb20 T A 18: 37,505,070 D216E probably damaging Het
Pcdhgb8 T A 18: 37,763,178 S434T possibly damaging Het
Pf4 T C 5: 90,772,589 V3A probably benign Het
Phf24 T C 4: 42,938,325 S229P probably benign Het
Plcd3 A G 11: 103,079,613 F200S probably damaging Het
Ppp1r16a A G 15: 76,690,904 H4R probably damaging Het
Pramef20 A G 4: 144,372,819 C459R probably damaging Het
Prdm10 A G 9: 31,316,442 probably null Het
Prkg1 T A 19: 30,585,199 H550L probably damaging Het
Prrc2c G T 1: 162,673,517 T2809N possibly damaging Het
Ptx3 A G 3: 66,224,970 E304G probably benign Het
Ralgps2 A G 1: 156,828,248 F369L probably benign Het
Rasgrp1 G A 2: 117,338,404 T31I probably benign Het
Rbsn A T 6: 92,191,334 M373K probably benign Het
Rnf168 C G 16: 32,282,361 R120G probably benign Het
Rp1 A G 1: 4,349,917 I324T probably damaging Het
Samd11 T C 4: 156,252,290 S31G probably benign Het
Sart3 A T 5: 113,745,995 L652Q probably benign Het
Scrn2 A G 11: 97,033,808 E421G probably benign Het
Sik2 A T 9: 50,917,097 L215Q probably damaging Het
Stard9 A T 2: 120,704,158 K3632M probably damaging Het
Swt1 A T 1: 151,388,677 D695E probably damaging Het
Tead3 T A 17: 28,333,254 M357L probably benign Het
Tgfbi A T 13: 56,628,016 T292S probably damaging Het
Tmc7 T C 7: 118,555,934 H247R probably benign Het
Trmt10b T A 4: 45,308,549 D236E probably damaging Het
Tshz1 C A 18: 84,015,927 V119L probably damaging Het
Ttn A C 2: 76,827,914 V12374G unknown Het
Tubgcp2 A G 7: 140,005,361 Y484H probably damaging Het
Ubr4 G C 4: 139,450,513 A1947P Het
Uggt1 A C 1: 36,155,107 V1350G probably benign Het
Vmn1r173 A T 7: 23,702,651 M104L probably benign Het
Xirp1 A T 9: 120,019,047 C257S probably damaging Het
Zfyve26 A G 12: 79,280,405 S724P probably damaging Het
Zmpste24 A T 4: 121,082,894 L185Q probably null Het
Zpld1 G A 16: 55,232,231 A340V probably benign Het
Other mutations in Prim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Prim2 APN 1 33512160 missense probably damaging 1.00
IGL02576:Prim2 APN 1 33484717 missense probably damaging 1.00
R0398:Prim2 UTSW 1 33484676 splice site probably benign
R0686:Prim2 UTSW 1 33514189 missense probably benign
R1452:Prim2 UTSW 1 33630404 missense probably benign
R3925:Prim2 UTSW 1 33533299 missense probably damaging 1.00
R4398:Prim2 UTSW 1 33512111 missense probably damaging 1.00
R4831:Prim2 UTSW 1 33670136 unclassified probably benign
R4832:Prim2 UTSW 1 33464064 missense probably benign
R5057:Prim2 UTSW 1 33630360 nonsense probably null
R5240:Prim2 UTSW 1 33480316 intron probably benign
R5294:Prim2 UTSW 1 33668893 missense probably benign 0.11
R5771:Prim2 UTSW 1 33454151 missense unknown
R5807:Prim2 UTSW 1 33480406 intron probably benign
R6307:Prim2 UTSW 1 33662292 missense probably benign 0.00
R8904:Prim2 UTSW 1 33630432 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCCAGCTAGCCATTAGTTAAC -3'
(R):5'- ACAACAGTTACTGACCTATTTCCC -3'

Sequencing Primer
(F):5'- CCAGCTAGCCATTAGTTAACCATTAG -3'
(R):5'- CCTGTTTTACTTGGGTCCCAGG -3'
Posted On2019-06-26