Incidental Mutation 'R7165:Kif21b'
ID557837
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7165 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136149448 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 403 (Y403H)
Ref Sequence ENSEMBL: ENSMUSP00000074661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: Y403H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: Y403H

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130864
AA Change: Y403H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: Y403H

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl C A 2: 128,123,108 A624E probably benign Het
Adnp A G 2: 168,182,367 S1003P probably benign Het
Akap8l T C 17: 32,338,412 D75G probably damaging Het
Ap4e1 A T 2: 127,063,318 T970S possibly damaging Het
Asb3 T A 11: 31,029,029 N106K probably damaging Het
Atp1a3 T C 7: 24,978,965 I988V probably benign Het
Camta1 A G 4: 151,084,700 L198S possibly damaging Het
Ccdc77 A G 6: 120,350,232 L84P probably damaging Het
Ccne1 C T 7: 38,099,301 A298T probably damaging Het
Cdc42bpb T A 12: 111,321,517 E532V probably damaging Het
Clasp2 G A 9: 113,786,399 probably null Het
Cntnap5b C A 1: 100,076,162 T289N possibly damaging Het
Dcun1d4 A G 5: 73,491,195 probably null Het
Dnah14 A G 1: 181,704,535 T2296A probably benign Het
Dnaja4 A T 9: 54,709,232 Q173L probably damaging Het
Dync2h1 G A 9: 7,050,479 A3190V probably benign Het
Frrs1 T A 3: 116,878,271 I6N probably benign Het
Fscn1 T C 5: 142,972,046 V477A probably benign Het
Fsip2 G A 2: 82,981,197 G2620E possibly damaging Het
Glp1r C T 17: 30,909,323 A92V probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm9573 A G 17: 35,621,978 S439P unknown Het
Gpr137b A T 13: 13,367,620 M204K probably damaging Het
Gstm1 A G 3: 108,016,377 V104A probably benign Het
Gtf2e1 A T 16: 37,535,866 N101K probably damaging Het
Igsf9b T C 9: 27,334,240 F1168L probably benign Het
Itpr2 A T 6: 146,294,091 V1629E probably damaging Het
Kat14 A G 2: 144,393,998 T428A probably benign Het
Lpcat1 G C 13: 73,514,530 A533P probably benign Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Mboat1 A T 13: 30,224,415 Y187F probably damaging Het
Mkx T C 18: 7,002,525 N7S probably damaging Het
Mrps27 A T 13: 99,414,799 T357S possibly damaging Het
Naa35 A G 13: 59,586,183 D9G probably benign Het
Ncoa4 T A 14: 32,175,983 N253K probably damaging Het
Neb A G 2: 52,270,306 Y2232H probably damaging Het
Nlk G A 11: 78,590,967 Q223* probably null Het
Npas2 T A 1: 39,292,717 I71N possibly damaging Het
Nup107 T A 10: 117,773,362 Q364L probably damaging Het
Olfr146 T A 9: 39,023,270 probably benign Het
Otof C T 5: 30,375,620 G1593S probably damaging Het
Panx3 G T 9: 37,664,085 H160Q probably damaging Het
Pappa T A 4: 65,261,873 H990Q probably damaging Het
Pax4 G A 6: 28,446,137 P119L probably damaging Het
Pcdhb20 T A 18: 37,505,070 D216E probably damaging Het
Pcdhgb8 T A 18: 37,763,178 S434T possibly damaging Het
Pf4 T C 5: 90,772,589 V3A probably benign Het
Phf24 T C 4: 42,938,325 S229P probably benign Het
Plcd3 A G 11: 103,079,613 F200S probably damaging Het
Ppp1r16a A G 15: 76,690,904 H4R probably damaging Het
Pramef20 A G 4: 144,372,819 C459R probably damaging Het
Prdm10 A G 9: 31,316,442 probably null Het
Prim2 A G 1: 33,628,393 probably null Het
Prkg1 T A 19: 30,585,199 H550L probably damaging Het
Prrc2c G T 1: 162,673,517 T2809N possibly damaging Het
Ptx3 A G 3: 66,224,970 E304G probably benign Het
Ralgps2 A G 1: 156,828,248 F369L probably benign Het
Rasgrp1 G A 2: 117,338,404 T31I probably benign Het
Rbsn A T 6: 92,191,334 M373K probably benign Het
Rnf168 C G 16: 32,282,361 R120G probably benign Het
Rp1 A G 1: 4,349,917 I324T probably damaging Het
Samd11 T C 4: 156,252,290 S31G probably benign Het
Sart3 A T 5: 113,745,995 L652Q probably benign Het
Scrn2 A G 11: 97,033,808 E421G probably benign Het
Sik2 A T 9: 50,917,097 L215Q probably damaging Het
Stard9 A T 2: 120,704,158 K3632M probably damaging Het
Swt1 A T 1: 151,388,677 D695E probably damaging Het
Tead3 T A 17: 28,333,254 M357L probably benign Het
Tgfbi A T 13: 56,628,016 T292S probably damaging Het
Tmc7 T C 7: 118,555,934 H247R probably benign Het
Trmt10b T A 4: 45,308,549 D236E probably damaging Het
Tshz1 C A 18: 84,015,927 V119L probably damaging Het
Ttn A C 2: 76,827,914 V12374G unknown Het
Tubgcp2 A G 7: 140,005,361 Y484H probably damaging Het
Ubr4 G C 4: 139,450,513 A1947P Het
Uggt1 A C 1: 36,155,107 V1350G probably benign Het
Vmn1r173 A T 7: 23,702,651 M104L probably benign Het
Xirp1 A T 9: 120,019,047 C257S probably damaging Het
Zfyve26 A G 12: 79,280,405 S724P probably damaging Het
Zmpste24 A T 4: 121,082,894 L185Q probably null Het
Zpld1 G A 16: 55,232,231 A340V probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0629_Kif21b_729 UTSW 1 136172157 critical splice acceptor site probably null
Schiessen UTSW 1 136147869 critical splice donor site probably null
wolfen UTSW 1 136144758 nonsense probably null
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
R7975:Kif21b UTSW 1 136171173 missense probably damaging 1.00
R8356:Kif21b UTSW 1 136172945 missense probably damaging 1.00
R8467:Kif21b UTSW 1 136172283 missense probably damaging 0.98
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136154137 missense probably benign 0.00
Z1177:Kif21b UTSW 1 136148312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCATGATCGCCTGTGTGAG -3'
(R):5'- CTCAGCCTGCACTGGTTTTG -3'

Sequencing Primer
(F):5'- TGTGTGAGCCCCTCGGATC -3'
(R):5'- AGTACTGGGACCCACATCTGATG -3'
Posted On2019-06-26