Incidental Mutation 'R0586:Tns2'
ID55785
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0586 (G1)
Quality Score193
Status Validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 102109585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
Predicted Effect probably benign
Transcript: ENSMUST00000046144
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169627
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229097
Predicted Effect probably benign
Transcript: ENSMUST00000229592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably benign
Transcript: ENSMUST00000230474
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Cfhr2 G A 1: 139,813,434 R268* probably null Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Fcgbp A T 7: 28,089,713 D568V probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
L3mbtl3 A G 10: 26,327,834 V366A unknown Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr1240 T A 2: 89,439,354 R308S possibly damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trim33 T A 3: 103,310,344 C202S probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ube2e3 T C 2: 78,919,990 Y187H probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1487:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1579:Tns2 UTSW 15 102111210 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1779:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2252:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3160:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3767:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
R7061:Tns2 UTSW 15 102104479 start codon destroyed probably null
R7070:Tns2 UTSW 15 102104533 missense possibly damaging 0.58
R7110:Tns2 UTSW 15 102105366 missense probably damaging 0.99
R7410:Tns2 UTSW 15 102110526 missense probably damaging 1.00
R7447:Tns2 UTSW 15 102110916 missense probably damaging 1.00
R7751:Tns2 UTSW 15 102109728 missense probably benign 0.02
R8052:Tns2 UTSW 15 102112845 missense probably damaging 1.00
R8114:Tns2 UTSW 15 102111390 missense probably benign 0.01
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCCATCAGAATGAACAGCAG -3'
(R):5'- AGGATTCCCCTCAGTGTTACAACCC -3'

Sequencing Primer
(F):5'- TGTTCCTGTGCTGCCAG -3'
(R):5'- CGTCGCCTTTGAGGAGAAG -3'
Posted On2013-07-11