Incidental Mutation 'R7165:Kat14'
ID557850
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Namelysine acetyltransferase 14
SynonymsD2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
MMRRC Submission
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7165 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location144368983-144407676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144393998 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 428 (T428A)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747]
Predicted Effect probably benign
Transcript: ENSMUST00000028911
AA Change: T428A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: T428A

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147747
AA Change: T217A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425
AA Change: T217A

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156410
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl C A 2: 128,123,108 A624E probably benign Het
Adnp A G 2: 168,182,367 S1003P probably benign Het
Akap8l T C 17: 32,338,412 D75G probably damaging Het
Ap4e1 A T 2: 127,063,318 T970S possibly damaging Het
Asb3 T A 11: 31,029,029 N106K probably damaging Het
Atp1a3 T C 7: 24,978,965 I988V probably benign Het
Camta1 A G 4: 151,084,700 L198S possibly damaging Het
Ccdc77 A G 6: 120,350,232 L84P probably damaging Het
Ccne1 C T 7: 38,099,301 A298T probably damaging Het
Cdc42bpb T A 12: 111,321,517 E532V probably damaging Het
Clasp2 G A 9: 113,786,399 probably null Het
Cntnap5b C A 1: 100,076,162 T289N possibly damaging Het
Dcun1d4 A G 5: 73,491,195 probably null Het
Dnah14 A G 1: 181,704,535 T2296A probably benign Het
Dnaja4 A T 9: 54,709,232 Q173L probably damaging Het
Dync2h1 G A 9: 7,050,479 A3190V probably benign Het
Frrs1 T A 3: 116,878,271 I6N probably benign Het
Fscn1 T C 5: 142,972,046 V477A probably benign Het
Fsip2 G A 2: 82,981,197 G2620E possibly damaging Het
Glp1r C T 17: 30,909,323 A92V probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm9573 A G 17: 35,621,978 S439P unknown Het
Gpr137b A T 13: 13,367,620 M204K probably damaging Het
Gstm1 A G 3: 108,016,377 V104A probably benign Het
Gtf2e1 A T 16: 37,535,866 N101K probably damaging Het
Igsf9b T C 9: 27,334,240 F1168L probably benign Het
Itpr2 A T 6: 146,294,091 V1629E probably damaging Het
Kif21b T C 1: 136,149,448 Y403H probably damaging Het
Lpcat1 G C 13: 73,514,530 A533P probably benign Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Mboat1 A T 13: 30,224,415 Y187F probably damaging Het
Mkx T C 18: 7,002,525 N7S probably damaging Het
Mrps27 A T 13: 99,414,799 T357S possibly damaging Het
Naa35 A G 13: 59,586,183 D9G probably benign Het
Ncoa4 T A 14: 32,175,983 N253K probably damaging Het
Neb A G 2: 52,270,306 Y2232H probably damaging Het
Nlk G A 11: 78,590,967 Q223* probably null Het
Npas2 T A 1: 39,292,717 I71N possibly damaging Het
Nup107 T A 10: 117,773,362 Q364L probably damaging Het
Olfr146 T A 9: 39,023,270 probably benign Het
Otof C T 5: 30,375,620 G1593S probably damaging Het
Panx3 G T 9: 37,664,085 H160Q probably damaging Het
Pappa T A 4: 65,261,873 H990Q probably damaging Het
Pax4 G A 6: 28,446,137 P119L probably damaging Het
Pcdhb20 T A 18: 37,505,070 D216E probably damaging Het
Pcdhgb8 T A 18: 37,763,178 S434T possibly damaging Het
Pf4 T C 5: 90,772,589 V3A probably benign Het
Phf24 T C 4: 42,938,325 S229P probably benign Het
Plcd3 A G 11: 103,079,613 F200S probably damaging Het
Ppp1r16a A G 15: 76,690,904 H4R probably damaging Het
Pramef20 A G 4: 144,372,819 C459R probably damaging Het
Prdm10 A G 9: 31,316,442 probably null Het
Prim2 A G 1: 33,628,393 probably null Het
Prkg1 T A 19: 30,585,199 H550L probably damaging Het
Prrc2c G T 1: 162,673,517 T2809N possibly damaging Het
Ptx3 A G 3: 66,224,970 E304G probably benign Het
Ralgps2 A G 1: 156,828,248 F369L probably benign Het
Rasgrp1 G A 2: 117,338,404 T31I probably benign Het
Rbsn A T 6: 92,191,334 M373K probably benign Het
Rnf168 C G 16: 32,282,361 R120G probably benign Het
Rp1 A G 1: 4,349,917 I324T probably damaging Het
Samd11 T C 4: 156,252,290 S31G probably benign Het
Sart3 A T 5: 113,745,995 L652Q probably benign Het
Scrn2 A G 11: 97,033,808 E421G probably benign Het
Sik2 A T 9: 50,917,097 L215Q probably damaging Het
Stard9 A T 2: 120,704,158 K3632M probably damaging Het
Swt1 A T 1: 151,388,677 D695E probably damaging Het
Tead3 T A 17: 28,333,254 M357L probably benign Het
Tgfbi A T 13: 56,628,016 T292S probably damaging Het
Tmc7 T C 7: 118,555,934 H247R probably benign Het
Trmt10b T A 4: 45,308,549 D236E probably damaging Het
Tshz1 C A 18: 84,015,927 V119L probably damaging Het
Ttn A C 2: 76,827,914 V12374G unknown Het
Tubgcp2 A G 7: 140,005,361 Y484H probably damaging Het
Ubr4 G C 4: 139,450,513 A1947P Het
Uggt1 A C 1: 36,155,107 V1350G probably benign Het
Vmn1r173 A T 7: 23,702,651 M104L probably benign Het
Xirp1 A T 9: 120,019,047 C257S probably damaging Het
Zfyve26 A G 12: 79,280,405 S724P probably damaging Het
Zmpste24 A T 4: 121,082,894 L185Q probably null Het
Zpld1 G A 16: 55,232,231 A340V probably benign Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTTTGCACAGATGACGATG -3'
(R):5'- TTGCCGGACGATCAGTTTCC -3'

Sequencing Primer
(F):5'- CTTTGCACAGATGACGATGAGCTG -3'
(R):5'- CGGACGATCAGTTTCCGTTTCAG -3'
Posted On2019-06-26