Mutagenetix > Incidental Mutation

Incidental Mutation 'R7165:Fscn1'

557866

Institutional Source

Beutler Lab

Gene Symbol

Fscn1

Ensembl Gene

ENSMUSG00000029581

Gene Name

fascin actin-bundling protein 1

Synonyms

Fan1, fascin-1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.496) question?

Stock #

R7165 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142960343-142973185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142972046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 477 (V477A)

Ref Sequence

ENSEMBL: ENSMUSP00000031565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031565] [ENSMUST00000198017]

AlphaFold

Q61553

Predicted Effect

probably benign
Transcript: ENSMUST00000031565
AA Change: V477A

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000031565
Gene: ENSMUSG00000029581
AA Change: V477A

Domain	Start	End	E-Value	Type
Pfam:Fascin	20	134	1.9e-37	PFAM
Pfam:Fascin	142	256	4.1e-30	PFAM
Pfam:Fascin	268	378	1.3e-36	PFAM
Pfam:Fascin	391	493	9.4e-24	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122862
Gene: ENSMUSG00000029581
AA Change: V224A

Domain	Start	End	E-Value	Type
Pfam:Fascin	16	126	1.1e-37	PFAM
Pfam:Fascin	139	241	8.3e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198017
AA Change: V316A

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142509
Gene: ENSMUSG00000029581
AA Change: V316A

Domain	Start	End	E-Value	Type
Pfam:Fascin	20	74	2.3e-12	PFAM
Pfam:Fascin	107	217	7.3e-34	PFAM
Pfam:Fascin	230	332	1.5e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired migration of mature dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	C	A	2: 128,123,108	A624E	probably benign	Het
Adnp	A	G	2: 168,182,367	S1003P	probably benign	Het
Akap8l	T	C	17: 32,338,412	D75G	probably damaging	Het
Ap4e1	A	T	2: 127,063,318	T970S	possibly damaging	Het
Asb3	T	A	11: 31,029,029	N106K	probably damaging	Het
Atp1a3	T	C	7: 24,978,965	I988V	probably benign	Het
Camta1	A	G	4: 151,084,700	L198S	possibly damaging	Het
Ccdc77	A	G	6: 120,350,232	L84P	probably damaging	Het
Ccne1	C	T	7: 38,099,301	A298T	probably damaging	Het
Cdc42bpb	T	A	12: 111,321,517	E532V	probably damaging	Het
Clasp2	G	A	9: 113,786,399		probably null	Het
Cntnap5b	C	A	1: 100,076,162	T289N	possibly damaging	Het
Dcun1d4	A	G	5: 73,491,195		probably null	Het
Dnah14	A	G	1: 181,704,535	T2296A	probably benign	Het
Dnaja4	A	T	9: 54,709,232	Q173L	probably damaging	Het
Dync2h1	G	A	9: 7,050,479	A3190V	probably benign	Het
Frrs1	T	A	3: 116,878,271	I6N	probably benign	Het
Fsip2	G	A	2: 82,981,197	G2620E	possibly damaging	Het
Glp1r	C	T	17: 30,909,323	A92V	probably benign	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Gm9573	A	G	17: 35,621,978	S439P	unknown	Het
Gpr137b	A	T	13: 13,367,620	M204K	probably damaging	Het
Gstm1	A	G	3: 108,016,377	V104A	probably benign	Het
Gtf2e1	A	T	16: 37,535,866	N101K	probably damaging	Het
Igsf9b	T	C	9: 27,334,240	F1168L	probably benign	Het
Itpr2	A	T	6: 146,294,091	V1629E	probably damaging	Het
Kat14	A	G	2: 144,393,998	T428A	probably benign	Het
Kif21b	T	C	1: 136,149,448	Y403H	probably damaging	Het
Lpcat1	G	C	13: 73,514,530	A533P	probably benign	Het
Lrp2	A	T	2: 69,506,573	I1285N	probably damaging	Het
Mboat1	A	T	13: 30,224,415	Y187F	probably damaging	Het
Mkx	T	C	18: 7,002,525	N7S	probably damaging	Het
Mrps27	A	T	13: 99,414,799	T357S	possibly damaging	Het
Naa35	A	G	13: 59,586,183	D9G	probably benign	Het
Ncoa4	T	A	14: 32,175,983	N253K	probably damaging	Het
Neb	A	G	2: 52,270,306	Y2232H	probably damaging	Het
Nlk	G	A	11: 78,590,967	Q223*	probably null	Het
Npas2	T	A	1: 39,292,717	I71N	possibly damaging	Het
Nup107	T	A	10: 117,773,362	Q364L	probably damaging	Het
Olfr146	T	A	9: 39,023,270		probably benign	Het
Otof	C	T	5: 30,375,620	G1593S	probably damaging	Het
Panx3	G	T	9: 37,664,085	H160Q	probably damaging	Het
Pappa	T	A	4: 65,261,873	H990Q	probably damaging	Het
Pax4	G	A	6: 28,446,137	P119L	probably damaging	Het
Pcdhb20	T	A	18: 37,505,070	D216E	probably damaging	Het
Pcdhgb8	T	A	18: 37,763,178	S434T	possibly damaging	Het
Pf4	T	C	5: 90,772,589	V3A	probably benign	Het
Phf24	T	C	4: 42,938,325	S229P	probably benign	Het
Plcd3	A	G	11: 103,079,613	F200S	probably damaging	Het
Ppp1r16a	A	G	15: 76,690,904	H4R	probably damaging	Het
Pramef20	A	G	4: 144,372,819	C459R	probably damaging	Het
Prdm10	A	G	9: 31,316,442		probably null	Het
Prim2	A	G	1: 33,628,393		probably null	Het
Prkg1	T	A	19: 30,585,199	H550L	probably damaging	Het
Prrc2c	G	T	1: 162,673,517	T2809N	possibly damaging	Het
Ptx3	A	G	3: 66,224,970	E304G	probably benign	Het
Ralgps2	A	G	1: 156,828,248	F369L	probably benign	Het
Rasgrp1	G	A	2: 117,338,404	T31I	probably benign	Het
Rbsn	A	T	6: 92,191,334	M373K	probably benign	Het
Rnf168	C	G	16: 32,282,361	R120G	probably benign	Het
Rp1	A	G	1: 4,349,917	I324T	probably damaging	Het
Samd11	T	C	4: 156,252,290	S31G	probably benign	Het
Sart3	A	T	5: 113,745,995	L652Q	probably benign	Het
Scrn2	A	G	11: 97,033,808	E421G	probably benign	Het
Sik2	A	T	9: 50,917,097	L215Q	probably damaging	Het
Stard9	A	T	2: 120,704,158	K3632M	probably damaging	Het
Swt1	A	T	1: 151,388,677	D695E	probably damaging	Het
Tead3	T	A	17: 28,333,254	M357L	probably benign	Het
Tgfbi	A	T	13: 56,628,016	T292S	probably damaging	Het
Tmc7	T	C	7: 118,555,934	H247R	probably benign	Het
Trmt10b	T	A	4: 45,308,549	D236E	probably damaging	Het
Tshz1	C	A	18: 84,015,927	V119L	probably damaging	Het
Ttn	A	C	2: 76,827,914	V12374G	unknown	Het
Tubgcp2	A	G	7: 140,005,361	Y484H	probably damaging	Het
Ubr4	G	C	4: 139,450,513	A1947P		Het
Uggt1	A	C	1: 36,155,107	V1350G	probably benign	Het
Vmn1r173	A	T	7: 23,702,651	M104L	probably benign	Het
Xirp1	A	T	9: 120,019,047	C257S	probably damaging	Het
Zfyve26	A	G	12: 79,280,405	S724P	probably damaging	Het
Zmpste24	A	T	4: 121,082,894	L185Q	probably null	Het
Zpld1	G	A	16: 55,232,231	A340V	probably benign	Het

Other mutations in Fscn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02189:Fscn1	APN	5	142960620	missense	possibly damaging	0.46
IGL02311:Fscn1	APN	5	142972010	missense	probably benign	0.08
R0037:Fscn1	UTSW	5	142970694	splice site	probably benign
R1163:Fscn1	UTSW	5	142960843	missense	probably damaging	1.00
R1860:Fscn1	UTSW	5	142970063	critical splice donor site	probably null
R4342:Fscn1	UTSW	5	142972021	missense	probably damaging	1.00
R5569:Fscn1	UTSW	5	142961044	missense	probably benign	0.13
R6248:Fscn1	UTSW	5	142961023	missense	possibly damaging	0.94
R6517:Fscn1	UTSW	5	142971986	missense	probably damaging	0.98
R6594:Fscn1	UTSW	5	142970028	missense	probably benign	0.02
R6964:Fscn1	UTSW	5	142960660	missense	probably damaging	1.00
R7000:Fscn1	UTSW	5	142960627	missense	probably damaging	1.00
R7108:Fscn1	UTSW	5	142960515	missense	probably damaging	1.00
R7233:Fscn1	UTSW	5	142970274	missense	possibly damaging	0.83
R8030:Fscn1	UTSW	5	142961001	missense	possibly damaging	0.95
R8121:Fscn1	UTSW	5	142960861	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCTTTGGGGACTGACAAGG -3'
(R):5'- AGAAAGGTGCCAGAGTTCCC -3'

Sequencing Primer
(F):5'- ACAAGGTGGGGTTAACATGTAGTCTC -3'
(R):5'- TGCCAGAGTTCCCCATGG -3'

Posted On

2019-06-26