Incidental Mutation 'R7165:Atp1a3'
ID557872
Institutional Source Beutler Lab
Gene Symbol Atp1a3
Ensembl Gene ENSMUSG00000040907
Gene NameATPase, Na+/K+ transporting, alpha 3 polypeptide
SynonymsAtpa-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7165 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24978167-25005958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24978965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 988 (I988V)
Ref Sequence ENSEMBL: ENSMUSP00000079691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684]
Predicted Effect probably benign
Transcript: ENSMUST00000080882
AA Change: I988V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907
AA Change: I988V

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 125 356 6.3e-64 PFAM
Pfam:Hydrolase 360 719 2.6e-32 PFAM
Pfam:HAD 363 716 4.7e-18 PFAM
Pfam:Hydrolase_like2 416 511 5.7e-26 PFAM
Pfam:Cation_ATPase_C 789 998 3.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102858
AA Change: I988V

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907
AA Change: I988V

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 124 355 4.6e-60 PFAM
Pfam:Hydrolase 360 719 5.7e-20 PFAM
Pfam:HAD 363 716 4.5e-19 PFAM
Pfam:Cation_ATPase 416 511 5.1e-25 PFAM
Pfam:Cation_ATPase_C 789 998 1.4e-46 PFAM
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196684
AA Change: I1001V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907
AA Change: I1001V

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Cation_ATPase_N 45 119 1.9e-26 SMART
Pfam:E1-E2_ATPase 137 368 4e-58 PFAM
Pfam:Hydrolase 373 732 3.8e-18 PFAM
Pfam:HAD 376 729 3.8e-17 PFAM
Pfam:Cation_ATPase 429 524 5.2e-23 PFAM
Pfam:Cation_ATPase_C 802 1011 2.5e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display neonatal lethality. Heterozygous mice display hyperactivity, increased activity in responses to methamphetamine, and impaired spatial learning. Mice heterozygous for an ENU mutation exhibit convulsive and vestibular stress induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl C A 2: 128,123,108 A624E probably benign Het
Adnp A G 2: 168,182,367 S1003P probably benign Het
Akap8l T C 17: 32,338,412 D75G probably damaging Het
Ap4e1 A T 2: 127,063,318 T970S possibly damaging Het
Asb3 T A 11: 31,029,029 N106K probably damaging Het
Camta1 A G 4: 151,084,700 L198S possibly damaging Het
Ccdc77 A G 6: 120,350,232 L84P probably damaging Het
Ccne1 C T 7: 38,099,301 A298T probably damaging Het
Cdc42bpb T A 12: 111,321,517 E532V probably damaging Het
Clasp2 G A 9: 113,786,399 probably null Het
Cntnap5b C A 1: 100,076,162 T289N possibly damaging Het
Dcun1d4 A G 5: 73,491,195 probably null Het
Dnah14 A G 1: 181,704,535 T2296A probably benign Het
Dnaja4 A T 9: 54,709,232 Q173L probably damaging Het
Dync2h1 G A 9: 7,050,479 A3190V probably benign Het
Frrs1 T A 3: 116,878,271 I6N probably benign Het
Fscn1 T C 5: 142,972,046 V477A probably benign Het
Fsip2 G A 2: 82,981,197 G2620E possibly damaging Het
Glp1r C T 17: 30,909,323 A92V probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm9573 A G 17: 35,621,978 S439P unknown Het
Gpr137b A T 13: 13,367,620 M204K probably damaging Het
Gstm1 A G 3: 108,016,377 V104A probably benign Het
Gtf2e1 A T 16: 37,535,866 N101K probably damaging Het
Igsf9b T C 9: 27,334,240 F1168L probably benign Het
Itpr2 A T 6: 146,294,091 V1629E probably damaging Het
Kat14 A G 2: 144,393,998 T428A probably benign Het
Kif21b T C 1: 136,149,448 Y403H probably damaging Het
Lpcat1 G C 13: 73,514,530 A533P probably benign Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Mboat1 A T 13: 30,224,415 Y187F probably damaging Het
Mkx T C 18: 7,002,525 N7S probably damaging Het
Mrps27 A T 13: 99,414,799 T357S possibly damaging Het
Naa35 A G 13: 59,586,183 D9G probably benign Het
Ncoa4 T A 14: 32,175,983 N253K probably damaging Het
Neb A G 2: 52,270,306 Y2232H probably damaging Het
Nlk G A 11: 78,590,967 Q223* probably null Het
Npas2 T A 1: 39,292,717 I71N possibly damaging Het
Nup107 T A 10: 117,773,362 Q364L probably damaging Het
Olfr146 T A 9: 39,023,270 probably benign Het
Otof C T 5: 30,375,620 G1593S probably damaging Het
Panx3 G T 9: 37,664,085 H160Q probably damaging Het
Pappa T A 4: 65,261,873 H990Q probably damaging Het
Pax4 G A 6: 28,446,137 P119L probably damaging Het
Pcdhb20 T A 18: 37,505,070 D216E probably damaging Het
Pcdhgb8 T A 18: 37,763,178 S434T possibly damaging Het
Pf4 T C 5: 90,772,589 V3A probably benign Het
Phf24 T C 4: 42,938,325 S229P probably benign Het
Plcd3 A G 11: 103,079,613 F200S probably damaging Het
Ppp1r16a A G 15: 76,690,904 H4R probably damaging Het
Pramef20 A G 4: 144,372,819 C459R probably damaging Het
Prdm10 A G 9: 31,316,442 probably null Het
Prim2 A G 1: 33,628,393 probably null Het
Prkg1 T A 19: 30,585,199 H550L probably damaging Het
Prrc2c G T 1: 162,673,517 T2809N possibly damaging Het
Ptx3 A G 3: 66,224,970 E304G probably benign Het
Ralgps2 A G 1: 156,828,248 F369L probably benign Het
Rasgrp1 G A 2: 117,338,404 T31I probably benign Het
Rbsn A T 6: 92,191,334 M373K probably benign Het
Rnf168 C G 16: 32,282,361 R120G probably benign Het
Rp1 A G 1: 4,349,917 I324T probably damaging Het
Samd11 T C 4: 156,252,290 S31G probably benign Het
Sart3 A T 5: 113,745,995 L652Q probably benign Het
Scrn2 A G 11: 97,033,808 E421G probably benign Het
Sik2 A T 9: 50,917,097 L215Q probably damaging Het
Stard9 A T 2: 120,704,158 K3632M probably damaging Het
Swt1 A T 1: 151,388,677 D695E probably damaging Het
Tead3 T A 17: 28,333,254 M357L probably benign Het
Tgfbi A T 13: 56,628,016 T292S probably damaging Het
Tmc7 T C 7: 118,555,934 H247R probably benign Het
Trmt10b T A 4: 45,308,549 D236E probably damaging Het
Tshz1 C A 18: 84,015,927 V119L probably damaging Het
Ttn A C 2: 76,827,914 V12374G unknown Het
Tubgcp2 A G 7: 140,005,361 Y484H probably damaging Het
Ubr4 G C 4: 139,450,513 A1947P Het
Uggt1 A C 1: 36,155,107 V1350G probably benign Het
Vmn1r173 A T 7: 23,702,651 M104L probably benign Het
Xirp1 A T 9: 120,019,047 C257S probably damaging Het
Zfyve26 A G 12: 79,280,405 S724P probably damaging Het
Zmpste24 A T 4: 121,082,894 L185Q probably null Het
Zpld1 G A 16: 55,232,231 A340V probably benign Het
Other mutations in Atp1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Atp1a3 APN 7 24997286 missense probably damaging 0.98
IGL02736:Atp1a3 APN 7 24980109 missense probably damaging 1.00
IGL02738:Atp1a3 APN 7 24990476 missense possibly damaging 0.86
IGL02806:Atp1a3 APN 7 24981872 missense probably damaging 1.00
borah UTSW 7 24994569 missense probably damaging 1.00
clonic UTSW 7 24987985 missense probably benign 0.37
R0003:Atp1a3 UTSW 7 24989564 splice site probably benign
R0254:Atp1a3 UTSW 7 24981512 splice site probably benign
R0420:Atp1a3 UTSW 7 24980627 missense probably benign
R0437:Atp1a3 UTSW 7 24998967 missense probably benign 0.36
R0666:Atp1a3 UTSW 7 24990549 missense probably benign 0.01
R0932:Atp1a3 UTSW 7 24987976 critical splice donor site probably null
R1586:Atp1a3 UTSW 7 24979383 missense probably damaging 0.97
R1981:Atp1a3 UTSW 7 25000975 missense probably benign 0.19
R2105:Atp1a3 UTSW 7 24989853 missense probably damaging 1.00
R3076:Atp1a3 UTSW 7 24980073 missense possibly damaging 0.48
R3110:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R3112:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R4223:Atp1a3 UTSW 7 25000930 missense probably benign 0.09
R4327:Atp1a3 UTSW 7 24987631 intron probably benign
R4598:Atp1a3 UTSW 7 24979341 missense probably damaging 0.99
R4626:Atp1a3 UTSW 7 24998768 missense possibly damaging 0.75
R4789:Atp1a3 UTSW 7 24998964 missense probably damaging 1.00
R4963:Atp1a3 UTSW 7 24994626 missense probably damaging 0.97
R5243:Atp1a3 UTSW 7 24994569 missense probably damaging 1.00
R5294:Atp1a3 UTSW 7 24988048 missense probably damaging 0.98
R5668:Atp1a3 UTSW 7 24978869 intron probably benign
R5704:Atp1a3 UTSW 7 24997311 missense probably damaging 0.98
R5870:Atp1a3 UTSW 7 24997578 missense probably benign 0.03
R5934:Atp1a3 UTSW 7 24978874 intron probably benign
R6183:Atp1a3 UTSW 7 24981752 missense probably damaging 1.00
R6492:Atp1a3 UTSW 7 24979304 missense probably damaging 1.00
R6996:Atp1a3 UTSW 7 24997626 missense probably damaging 1.00
R7229:Atp1a3 UTSW 7 24987985 missense probably benign 0.37
R7239:Atp1a3 UTSW 7 25000704 missense probably damaging 1.00
R7301:Atp1a3 UTSW 7 24990515 missense probably benign 0.00
R7330:Atp1a3 UTSW 7 25001152 nonsense probably null
R7348:Atp1a3 UTSW 7 24978826 missense unknown
R7432:Atp1a3 UTSW 7 25005875 unclassified probably benign
R7490:Atp1a3 UTSW 7 24987470 missense probably damaging 1.00
R7556:Atp1a3 UTSW 7 24981566 missense probably benign 0.02
R7860:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7861:Atp1a3 UTSW 7 25001148 missense unknown
R7943:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7944:Atp1a3 UTSW 7 25001148 missense unknown
R8002:Atp1a3 UTSW 7 25000671 missense probably damaging 1.00
R8010:Atp1a3 UTSW 7 24980645 missense possibly damaging 0.90
Z1176:Atp1a3 UTSW 7 24998688 missense probably benign 0.00
Z1177:Atp1a3 UTSW 7 24980119 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGCACTTGGAAAGAGAGTG -3'
(R):5'- CACCCTGGTGTTTCTCTGGATG -3'

Sequencing Primer
(F):5'- CACTTGGAAAGAGAGTGAAAGGC -3'
(R):5'- GCTGATGCCACCAAGTCTC -3'
Posted On2019-06-26