Incidental Mutation 'R7165:Dnaja4'
ID557881
Institutional Source Beutler Lab
Gene Symbol Dnaja4
Ensembl Gene ENSMUSG00000032285
Gene NameDnaJ heat shock protein family (Hsp40) member A4
Synonyms1110021L12Rik, Hsj4, Dj4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7165 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location54698873-54716315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54709232 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 173 (Q173L)
Ref Sequence ENSEMBL: ENSMUSP00000070413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070070] [ENSMUST00000120452] [ENSMUST00000154690]
Predicted Effect probably damaging
Transcript: ENSMUST00000070070
AA Change: Q173L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070413
Gene: ENSMUSG00000032285
AA Change: Q173L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 2.1e-15 PFAM
Pfam:CTDII 258 340 4.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120452
AA Change: Q173L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112520
Gene: ENSMUSG00000032285
AA Change: Q173L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_C 108 330 9.7e-35 PFAM
Pfam:DnaJ_CXXCXGXG 135 201 1.5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154690
AA Change: Q173L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119602
Gene: ENSMUSG00000032285
AA Change: Q173L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl C A 2: 128,123,108 A624E probably benign Het
Adnp A G 2: 168,182,367 S1003P probably benign Het
Akap8l T C 17: 32,338,412 D75G probably damaging Het
Ap4e1 A T 2: 127,063,318 T970S possibly damaging Het
Asb3 T A 11: 31,029,029 N106K probably damaging Het
Atp1a3 T C 7: 24,978,965 I988V probably benign Het
Camta1 A G 4: 151,084,700 L198S possibly damaging Het
Ccdc77 A G 6: 120,350,232 L84P probably damaging Het
Ccne1 C T 7: 38,099,301 A298T probably damaging Het
Cdc42bpb T A 12: 111,321,517 E532V probably damaging Het
Clasp2 G A 9: 113,786,399 probably null Het
Cntnap5b C A 1: 100,076,162 T289N possibly damaging Het
Dcun1d4 A G 5: 73,491,195 probably null Het
Dnah14 A G 1: 181,704,535 T2296A probably benign Het
Dync2h1 G A 9: 7,050,479 A3190V probably benign Het
Frrs1 T A 3: 116,878,271 I6N probably benign Het
Fscn1 T C 5: 142,972,046 V477A probably benign Het
Fsip2 G A 2: 82,981,197 G2620E possibly damaging Het
Glp1r C T 17: 30,909,323 A92V probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm9573 A G 17: 35,621,978 S439P unknown Het
Gpr137b A T 13: 13,367,620 M204K probably damaging Het
Gstm1 A G 3: 108,016,377 V104A probably benign Het
Gtf2e1 A T 16: 37,535,866 N101K probably damaging Het
Igsf9b T C 9: 27,334,240 F1168L probably benign Het
Itpr2 A T 6: 146,294,091 V1629E probably damaging Het
Kat14 A G 2: 144,393,998 T428A probably benign Het
Kif21b T C 1: 136,149,448 Y403H probably damaging Het
Lpcat1 G C 13: 73,514,530 A533P probably benign Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Mboat1 A T 13: 30,224,415 Y187F probably damaging Het
Mkx T C 18: 7,002,525 N7S probably damaging Het
Mrps27 A T 13: 99,414,799 T357S possibly damaging Het
Naa35 A G 13: 59,586,183 D9G probably benign Het
Ncoa4 T A 14: 32,175,983 N253K probably damaging Het
Neb A G 2: 52,270,306 Y2232H probably damaging Het
Nlk G A 11: 78,590,967 Q223* probably null Het
Npas2 T A 1: 39,292,717 I71N possibly damaging Het
Nup107 T A 10: 117,773,362 Q364L probably damaging Het
Olfr146 T A 9: 39,023,270 probably benign Het
Otof C T 5: 30,375,620 G1593S probably damaging Het
Panx3 G T 9: 37,664,085 H160Q probably damaging Het
Pappa T A 4: 65,261,873 H990Q probably damaging Het
Pax4 G A 6: 28,446,137 P119L probably damaging Het
Pcdhb20 T A 18: 37,505,070 D216E probably damaging Het
Pcdhgb8 T A 18: 37,763,178 S434T possibly damaging Het
Pf4 T C 5: 90,772,589 V3A probably benign Het
Phf24 T C 4: 42,938,325 S229P probably benign Het
Plcd3 A G 11: 103,079,613 F200S probably damaging Het
Ppp1r16a A G 15: 76,690,904 H4R probably damaging Het
Pramef20 A G 4: 144,372,819 C459R probably damaging Het
Prdm10 A G 9: 31,316,442 probably null Het
Prim2 A G 1: 33,628,393 probably null Het
Prkg1 T A 19: 30,585,199 H550L probably damaging Het
Prrc2c G T 1: 162,673,517 T2809N possibly damaging Het
Ptx3 A G 3: 66,224,970 E304G probably benign Het
Ralgps2 A G 1: 156,828,248 F369L probably benign Het
Rasgrp1 G A 2: 117,338,404 T31I probably benign Het
Rbsn A T 6: 92,191,334 M373K probably benign Het
Rnf168 C G 16: 32,282,361 R120G probably benign Het
Rp1 A G 1: 4,349,917 I324T probably damaging Het
Samd11 T C 4: 156,252,290 S31G probably benign Het
Sart3 A T 5: 113,745,995 L652Q probably benign Het
Scrn2 A G 11: 97,033,808 E421G probably benign Het
Sik2 A T 9: 50,917,097 L215Q probably damaging Het
Stard9 A T 2: 120,704,158 K3632M probably damaging Het
Swt1 A T 1: 151,388,677 D695E probably damaging Het
Tead3 T A 17: 28,333,254 M357L probably benign Het
Tgfbi A T 13: 56,628,016 T292S probably damaging Het
Tmc7 T C 7: 118,555,934 H247R probably benign Het
Trmt10b T A 4: 45,308,549 D236E probably damaging Het
Tshz1 C A 18: 84,015,927 V119L probably damaging Het
Ttn A C 2: 76,827,914 V12374G unknown Het
Tubgcp2 A G 7: 140,005,361 Y484H probably damaging Het
Ubr4 G C 4: 139,450,513 A1947P Het
Uggt1 A C 1: 36,155,107 V1350G probably benign Het
Vmn1r173 A T 7: 23,702,651 M104L probably benign Het
Xirp1 A T 9: 120,019,047 C257S probably damaging Het
Zfyve26 A G 12: 79,280,405 S724P probably damaging Het
Zmpste24 A T 4: 121,082,894 L185Q probably null Het
Zpld1 G A 16: 55,232,231 A340V probably benign Het
Other mutations in Dnaja4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Dnaja4 APN 9 54714510 missense possibly damaging 0.93
PIT4305001:Dnaja4 UTSW 9 54710634 missense probably benign 0.01
R2139:Dnaja4 UTSW 9 54709222 missense probably benign 0.01
R4837:Dnaja4 UTSW 9 54710644 missense probably benign 0.00
R5087:Dnaja4 UTSW 9 54699739 missense probably damaging 0.99
R5862:Dnaja4 UTSW 9 54699341 unclassified probably benign
R6722:Dnaja4 UTSW 9 54699754 missense probably damaging 0.99
R6985:Dnaja4 UTSW 9 54708395 missense probably benign 0.06
R7228:Dnaja4 UTSW 9 54714285 missense possibly damaging 0.88
R7762:Dnaja4 UTSW 9 54709210 missense probably benign 0.03
X0057:Dnaja4 UTSW 9 54699804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTAAGCACAGTGCCCAG -3'
(R):5'- TCTTGTAAGCATGCTGCCAC -3'

Sequencing Primer
(F):5'- GCTCCCTGCTGAGAGGAACAC -3'
(R):5'- ATGTGCGCCATGATTAGCAG -3'
Posted On2019-06-26